Transcript

nrg1-205

ID
ZDB-TSCRIPT-091110-810
Name
nrg1-205
Previous Names
  • nrg1-004
  • ch211-197l9.2-001
  • ottdart00000042852
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042852 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042852|OTTDARG00000019703|ZDB-GENE-050302-113 nrg1|OTTDARP00000034020 nrg1-004 LG_none BX321906.30,CR855879.8,CU459101.9,BX537303.10 Danio rerio protein_coding KNOWN, 2645 bp
CACATTCACACTGCGCACTACTCAACTAACTGACAACACT
GACTGAAATCCCACATCTAAACTGCATCATGGCTGAGGTG
AAAGCAGGCAAAGAAGGGAAAAGTGGCGATAAGAAAAAGG
ATAAGGAGTCTGTGAGATCAAACAAGCCTGACAACTCTCC
GCAAGCGGAACCGAAGTTAAAAAACCTTCGGAGCGTGACA
GTGGAGGACGGGAAAAAAACGGTACTCAAATGTGAGATTT
TGGCAGGAAACCCAGCGCCCAATGTCAAGTGGTACAAGAA
CGGAAAAGAGCTCACAGGCAAAAACAAACCCAAAAGCATA
AAGATTAAAAAAAAGAAACAGGGGAAAATATCTGAACTGT
TGATACGGAAATCCACGGAGGGAGATGCTGGATTATACAC
CTGCGAGGCCGTCAACAGCCTTGGAAAAACAAATACCACA
GCAAACCTATTCATCATCAACACAGCCACCAGCACCACTC
CCTCGGCCAAGACATCCAGTCACGTGACGCCCTGCAATGA
GAGCGAGAAGGAATACTGTGTAAACCATGGCAAGTGCTTC
ACGCTGGAGGTCACACCAGGCAACATCAGGCGCCTCTGCA
GGTGCCCTCCAGGATTCACAGGGAACCGCTGTCAAAACAG
AGACCCTGTGCGAGTCGTAGACCACAAACAAGCTGAGGAG
CTCTATCAGAAACGCGTTTTGACTATAACAGGCATCTGCA
TCGCTCTTCTAGTTGTTGGCATCATGTGTGTGGTGGCTTA
CTGCAAAACAAAGAAACAACGGAAAAAGCTACATGATCGT
TTGCGGCAGAGTTTACGAGAGCGAAACGCTGCAGCCAAAG
GCCCTCAACACCCTCACCCTCCACCGGAAAACCTGCAGCT
GGTCAATCATTACATGCCGACGAATCCTGTCCCAGCTCAT
ATGACAGACAAAGAAGCGGAAACATCACTCTCCACAAATG
AGTTCACATCACCAACACATCCGTCCACAGCCATCACTCA
CTCATCTAGCCAATGCTGGAGTAATGGCAAAGCAGAGAGT
GTGGTTTCTGATAGTCATGCAGTCCTGATGAAGCCATCAG
CTGAGAACTGTCAGCACGGGACACCTAGTCACAGGGGCCG
TCTGAACGCTACTGGAGGTGTCCATCAGCTCAATGATTAC
CTAAAGAACTCCAGAGAAGCCCAGGGCTCCAACAGAGACT
CTCCTTACAGCGAGAGGTATGTTTCAGCCATGACTACCCC
GACCCGTCTGTCCCCTGTGGGGCTTCTCTCGCCGGTGACG
CCGTCCTCTCCTCCCTCAGAGATGTCAGCTCCTCTCTCCA
GCCTGGCGACCTCCGTCCCATCCATGTTAACCAGTCCCTC
TGGAGAAGAGGAGCGTCCTCTGCTGTTCCGGACACCACCA
ATCCTGCGTGACAAATCTGCTTCAACCCAAGGCCGTAAAT
CAGGCCATAATCTCCGTAACTCCGCCCACTACAATCACGG
CCTGGACATCCCCAGCCCTCCACCCAGCCCGCTGCATATA
GAGGAGGAGATTGATTGTTTAGAGCAGTACAAAAGCACAT
CTGTCCCGTCCTCCGCCCCGCACAGCCCCAGCGCCGCAAG
AACTCAACCGAGTGGTCAAGCGGCGCCTGAGCAAGCGGTT
AGTGGCAGTAACTCAGAGAGCAGCAGCTCAGAGAGCGAGA
CCGAGGATGAACGGGTGGGCGAGGACACGCCGTTTCTGGG
CTTACAGAACCCTCTGGCCGCTGGTTCGCTTGTTCTGGAC
GGGCTAGAGGGCAGCAGAACTAACCCCGCGCTGCACCTCT
CACCGCAACACGAGCTGCAGAACAGACTAACAGCCGTCAT
GGCCAACCAGGATCCTATAGCTGTGTGAAAATGCATCCAA
GAAGAAAAACAAATCACCACTAAACCTTTATTTTCTATAA
TTAAGTATTTGCGAAAGAAAAACGTCGACTTTTATTTTAG
CGATGTAGTAAAAACAAAGACTTTTATAACGTGTACAATG
TGTGTGTCATGGAAAAAAAAGTGCCATTCACATGTAGCTG
AGGTCACAGTATTTCAAATGGCAGAAAAAATATAATAAAT
GGTGCCTTTTAATTTCAGAACTGCATTATGACACTGGGCC
ATATATTCATGACTTTAAAGCAACTAAATAAATTCTGTGA
CTGAGAGATGAAGAAAAAAAAATCCACCAGCACTCCATGT
CTGAATTCTAGCGTTCGGATTAAAGTGTAAATGTGCGTCA
GGATCTTCTAACCTAGTGTTTTTCAGTCCTGATAATGGGA
ACCCACTTCAACATTTTGCTTTAATTCTGTCTTATTTAAC
CCATCGATTCATATCATCAGCTCCATGAACTGAACTGTGT
CTGATAAGAGAGCTGTGGGTCGCCAGGACCAGGATTGAAA
ACCTGGAGGTTTCTATTTTTGCGTTAATTATTTGCGTTTT
GATTTCAAATATGTGAGGCTGCTGCAAACTGAAAACGAGA
CAATTCAAAAAGCTCTAAACATGCTACAAACACATTCACA
ATGTACAATCAGCTATTAATCCAATATAATCACGTTATTC
CGTTTGATATTATACTGTAGGTGAAGCAGACGTTGATGTT
TTCTGAATCATGACTGAATATATGGCTCACTATGTCGATC
GGCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations