Transcript

nrg1-202

ID
ZDB-TSCRIPT-091110-78
Name
nrg1-202
Previous Names
  • nrg1-003
  • dkeyp-73e12.6-001
  • ottdart00000042851
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042851 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042851|OTTDARG00000019703|ZDB-GENE-050302-113 nrg1|OTTDARP00000034019 nrg1-003 LG_none BX321906.30,CR855879.8,CU459101.9,BX537303.10 Danio rerio protein_coding KNOWN, 2193 bp
ATGGCGATTCTGCCAGGACGCAGCAGCTCTTTAACGGTCT
CGGTTCTTTACGGAGCGGCGGTGTGTTTGTCCCTGTGGAC
GCGTGTTGTCCGGTGTGGGAGTTTTGCGTGTTCTCCGCCC
GGGGCGTCAGTGCAGGAGCTCGCCCGCCGCTCGGGGGTCG
TGTTTGAGGGGAAGCTCCAGGAGGAAGAGCGAGCGGAGCG
AAACTGGACCGAGACGCCGATGAACGCCTCGCGTCAGGTG
CGGGTCAGAGTGCAGCAGGTGTGGCAGCTGAAGGCAGGAG
GGCTGATCAAGGACTCTGTAGTGTCTCTCGTCTGGTTTGA
AGGGGGCAGATGTTTCCAGCTGAACACAGGGATCCGCTAC
ATGTTCTTCATTGAACCCACAAATGACACGTCCGTTTTCA
CGGCAGTTTTCCCGCCGGTGGAGACCAAACGCACCGTTAG
GAAGGATGTGAGTCAGGTGCTCTGTCAGGATTGCGCGGAA
CCGAAGTTAAAAAACCTTCGGAGCGTGACAGTGGAGGACG
GGAAAAAAACGGTACTCAAATGTGAGATTTTGGCAGGAAA
CCCAGCGCCCAATGTCAAGTGGTACAAGAACGGAAAAGAG
CTCACAGGCAAAAACAAACCCAAAAGCATAAAGATTAAAA
AAAAGAAACAGGGGAAAATATCTGAACTGTTGATACGGAA
ATCCACGGAGGGAGATGCTGGATTATACACCTGCGAGGCC
GTCAACAGCCTTGGAAAAACAAATACCACAGCAAACCTAT
TCATCATCAACACAGCCACCAGCACCACTCCCTCGGCCAA
GACATCCAGTCACGTGACGCCCTGCAATGAGAGCGAGAAG
GAATACTGTGTAAACCATGGCAAGTGCTTCACGCTGGAGG
TCACACCAGGCAACATCAGGCGCCTCTGCAGGTGCCCCAA
TGAGTTTACTGGTGATCGCTGCCAACACTACGTAATGGCC
AGCTTCTACAAACATCTTGGGATTGAATTTATGGAAGCTG
AGGAGCTCTATCAGAAACGCGTTTTGACTATAACAGGCAT
CTGCATCGCTCTTCTAGTTGTTGGCATCATGTGTGTGGTG
GCTTACTGCAAAACAAAGAAACAACGGAAAAAGCTACATG
ATCGTTTGCGGCAGAGTTTACGAGAGCGAAACGCTGCAGC
CAAAGGCCCTCAACACCCTCACCCTCCACCGGAAAACCTG
CAGCTGGTCAATCATTACATGCCGACGAATCCTGTCCCAG
CTCATATGACAGACAAAGAAGCGGAAACATCACTCTCCAC
AAATGAGTTCACATCACCAACACATCCGTCCACAGCCATC
ACTCACTCATCTAGCCAATGCTGGAGTAATGGCAAAGCAG
AGAGTGTGGTTTCTGATAGTCATGCAGTCCTGATGAAGCC
ATCAGCTGAGAACTGTCAGCACGGGACACCTAGTCACAGG
GGCCGTCTGAACGCTACTGGAGGTGTCCATCAGCTCAATG
ATTACCTAAAGAACTCCAGAGAAGCCCAGGGCTCCAACAG
AGACTCTCCTTACAGCGAGAGGTATGTTTCAGCCATGACT
ACCCCGACCCGTCTGTCCCCTGTGGGGCTTCTCTCGCCGG
TGACGCCGTCCTCTCCTCCCTCAGAGATGTCAGCTCCTCT
CTCCAGCCTGGCGACCTCCGTCCCATCCATGTTAACCAGT
CCCTCTGGAGAAGAGGAGCGTCCTCTGCTGTTCCGGACAC
CACCAATCCTGCGTGACAAATCTGCTTCAACCCAAGGCCG
TAAATCAGGCCATAATCTCCGTAACTCCGCCCACTACAAT
CACGGCCTGGACATCCCCAGCCCTCCACCCAGCCCGCTGC
ATATAGAGGAGGAGATTGATTGTTTAGAGCAGTACAAAAG
CACATCTGTCCCGTCCTCCGCCCCGCACAGCCCCAGCGCC
GCAAGAACTCAACCGAGTGGTCAAGCGGCGCCTGAGCAAG
CGGTTAGTGGCAGTAACTCAGAGAGCAGCAGCTCAGAGAG
CGAGACCGAGGATGAACGGGTGGGCGAGGACACGCCGTTT
CTGGGCTTACAGAACCCTCTGGCCGCTGGTTCGCTTGTTC
TGGACGGGCTAGAGGGCAGCAGAACTAACCCCGCGCTGCA
CCTCTCACCGCAACACGAGCTGCAGAACAGACTAACAGCC
GTCATGGCCAACCAGGATCCTATAGCTGTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations