Transcript

nrg1-002

ID
ZDB-TSCRIPT-090929-7164
Name
nrg1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024296 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024296|OTTDARG00000019703|ZDB-GENE-050302-113 nrg1|no_translation nrg1-002 LG_none BX321906.30,CR855879.8,CU459101.9,BX537303.10 Danio rerio protein_coding KNOWN, 511 bp
CAGGGGCTTCTGCTTAATGCCGCGTGCTGTGTGGTCACTA
ATTCCAGCTCATCTGATAATGGGAACAACTCATCAGTCCA
TGTCAGTATTGGAGGACTGAGATAATAATGGTGGAAGGCA
ATGCACATGCTTATGTGGATAAAAGAGTGCGAATGTCATC
ATTTAAAGATCATTTCAAAACTTAGTCAGACTGTGCTGAT
GTCAAGGATGAGTCGGAATCTGACTAATCTGGTCAACAGA
TGGCCACTGTCTGGGTTAACGTAATAGATTTGGAGACTCT
TCTGTTCCAACAGCCACCAGCACCACTCCCTCGGCCAAGA
CATCCAGTCACGTGACGCCCTGCAATGAGAGCGAGAAGGA
ATACTGTGTAAACCATGGCAAGTGCTTCACGCTGGAGGTC
ACACCAGGCAACATCAGGCGCCTCTGCAGGTGCCCCAATG
AGTTTACTGGTGATCGCTGCCAACACTACGTAATGGCCAG
CTTCTACAGAAACAACGGAAAAAGCTACATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations