Transcript

rps2-003

ID
ZDB-TSCRIPT-091110-1417
Name
rps2-003
Previous Names
  • ch73-50o20.2-001-001
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045404 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045404|OTTDARG00000019704|ZDB-GENE-040426-2454 rps2|no_translation rps2-003 LG_ CR392027.16 Danio rerio protein_coding KNOWN, 349 bp
CAAATGGCGGACGACGCCGGTGGTAGAGGAGGTTTTCGCG
GAGGTTTCGGCACTGGCGGCCGGGGTCGCGGTCGTGGCCG
CGGCAGGGGCCGTGGAAGAGGCCGCGGTGCCCGGGGAGGA
AAATCCGAAGATAAGGAGTGGGTGCCTGTGACCAAACTTG
GTCGTCTGGTGAAGGACATGAAGATCAAGTCCCTGGAGGA
GATCTATCTGTATTCTCTGCCAATCAAGGTATTGAAGTTG
ACATGAAAACTGGCCATTATATATGTATAATATGGTGTAT
ATATTACAGTGTTTTCTATTTACCTACTATAATCATTACT
AGCTTTACTTTGTATTGAATAATGTTATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations