Transcript

rps2-204

ID
ZDB-TSCRIPT-090929-7166
Name
rps2-204
Previous Names
  • rps2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024298 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024298|OTTDARG00000019704|ZDB-GENE-040426-2454 rps2|OTTDARP00000020088 rps2-002 LG_ CR392027.16 Danio rerio protein_coding KNOWN, 777 bp
GGCCTTCTTCTTCCTGAATACACATCACGTAAGTCAACAT
GGGTTTCTCGCTCTGATTATCTGCATCTGCTGCTATCCCT
GCAATCGCAAAATAAAAACATCAAAATGTGTTCAGGACAT
GTGTGCGCGTGGATTTTTAACCACATGATGAAGAAATTAA
TTATATGATTTTAGTGTAAATGTTTTATTTTTATCGTAAC
TAGACTAGACGAGCGCAAAAATGGCGGCACGGGTGATCAG
TCGTATAAATAGATGATATTGTTAACATGTTTAAAATAAG
TAATGCGTACGGCTTTATTTTATCAGCTATAGTGTAAGTT
ACATGATAGTTAATGTAACGATAGTAACGCAACAAGCGCA
TGTTAATCGGCATGTGTCATAACTATAACGATATTCATAA
CGTGTTAATTAACGGAAAATGTTTACATTTCTATTCCAAA
GCAAATGGCGGACGACGCCGGTGGTAGAGGAGGTTTTCGC
GGAGGTTTCGGCACTGGCGGCCGGGGTCGCGGTCGTGGCC
GCGGCAGGGGCCGTGGAAGAGGCCGCGGTGCCCGGGGAGG
AAAATCCGAAGATAAGGAGTGGGTGCCTGTGACCAAACTT
GGTCGTCTGGTGAAGGACATGAAGATCAAGTCCCTGGAGG
AGATCTATCTGTATTCTCTGCCAATCAAGGAGTCTGAGAT
CATTGACTTCTTCTTGGGATCGGCGCTGAAGGATGAAGTC
CTGAAGATCATGCCTGTCCAGAAACAGACCAGGGCCGGTC
AGCGCACCAGGTTTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations