Transcript

rps2-203

ID
ZDB-TSCRIPT-090929-7165
Name
rps2-203
Previous Names
  • rps2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024297 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024297|OTTDARG00000019704|ZDB-GENE-040426-2454 rps2|OTTDARP00000020087 rps2-001 LG_ CR392027.16 Danio rerio protein_coding KNOWN, 919 bp
GGCCTTCTTCTTCCTGAATACACATCACCAAATGGCGGAC
GACGCCGGTGGTAGAGGAGGTTTTCGCGGAGGTTTCGGCA
CTGGCGGCCGGGGTCGCGGTCGTGGCCGCGGCAGGGGCCG
TGGAAGAGGCCGCGGTGCCCGGGGAGGAAAATCCGAAGAT
AAGGAGTGGGTGCCTGTGACCAAACTTGGTCGTCTGGTGA
AGGACATGAAGATCAAGTCCCTGGAGGAGATCTATCTGTA
TTCTCTGCCAATCAAGGAGTCTGAGATCATTGACTTCTTC
TTGGGATCGGCGCTGAAGGATGAAGTCCTGAAGATCATGC
CTGTCCAGAAACAGACCAGGGCCGGTCAGCGCACCAGGTT
TAAGGCCTTTGTTGCTATCGGTGACTACAATGGCCATGTT
GGTCTGGGGGTGAAGTGCTCTAAAGAAGTGGCCACCGCTA
TCCGAGGAGCCATCATCCTGGCCAAGCTGTCCATCATTCC
CGTCAGAAGAGGATACTGGGGTAACAAGATCGGAAAGCCA
CACACCGTGCCATGCAAGGTGACCGGTCGCTGTGGTTCAG
TCCTGGTGCGTCTCATTCCTGCTCCCCGTGGTACTGGTAT
CGTGTCTGCTCCTGTGCCCAAGAAGCTGCTGATGATGGCT
GGTATTGACGACTGCTACACCTCTGCCAGGGGCTGCACCG
CTACTCTGGGCAACTTTGCCAAGGCCACCTTTGACGCGAT
CTCAAAGACCTACAGCTACCTGACCCCTGATCTCTGGAAG
GAAACAGTGTTCACCAAGTCTCCTTACCAGGAATTCACTG
ATCATCTGGCCAAGACTCACACCAGGGTCTCCGTTCAGAG
GACTCAGGGAGCTCTTCCTCAGGGAACCTCCTAAATTTTG
TACAACGGATTGAAATAAAAGTCCAGAAGTAAAACCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations