header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4818
Transcript Name: col9a2-201
Previous Name: col9a2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020604 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020604|OTTDARG00000017093|ZDB-GENE-030131-9786 col9a2|OTTDARP00000017403 col9a2-001 LG_ BX276085.8 Danio rerio protein_coding KNOWN, 3163 bp
GGGGCTGGCTGTAGGGCTGGGTTACACCTCTCTCATTCCT
CCCCTCAAGTCTCTGCCACTGTGTTTTTCTTCCCCGTCCT
GGGCACAGCACACACGCTCACACACACCTCTCCTTTTTCC
CTGAATCCACCATCCTGGGCTGAGAAGCCAGGAGAGAGGG
TGGCAAGGTTTGGAGGAACCGTTGGATTTTGGATAGTGAA
TCTTCACCATGGCTGAGTTCTTCATCGTCCTCAGGAGTTT
GGTTCTGCTGCAGGTCCTCTGCTTGGCCTTATCGCAAGTG
ACCGGTCCACCCGGAGCTCAAGGCCCCGCTGGTTCCCCTG
GTCCTGCTGGAACTCCCGGAGCCGACGGCATTGATGGTGA
GAAGGGACCCCCTGGACCTCCTGGACCAAGAGGTCAAAAG
GGAGAGTCGGGTGAGCCTGGGCCTGATGGACCCCCGGGTG
AAGATGGCATTGATGGTTTGATTGGGGCGAAAGGTGAGAG
GGGTCCTCGTGGTAATCCTGGACCAAAGGGTCAGCCAGGG
CCTAGAGGACCAGCAGGACGACCTGGACCTGGACTGCCTG
GACTTCCTGGAGCAGCAGGGCCCATTGGGCTTCCTGGACA
AATTGGACCTACAGGACCAAAGGGTGTCATGGGAAGTCCC
GGACCTTCAGGATTACCAGGACCTCCAGGCAAGCCTGGTC
CACCAGGGAAGTTTTTGGGTCTAGAGGAAGGCAGCGCCGA
CTTTCAGTGTCCAACCAACTGTCCACCGGGACCAAAGGGT
CCTCAGGGCCTGCAGGGAGTCAAGGGACACAAAGGTCGTT
CTGGGGTGTTGGGAGATCCAGGAAGCATCGGAAAAACGGG
TATAAAAGGTGAAGTTGGCATCTCCGGTGAACAAGGGATC
CCAGGCCCTCCAGGCCCTCAGGGTCTGAGAGGGTATCCAG
GAATGGTGGGGCCAAAAGGCGAGACGGGACCACAAGGTTA
TAAAGGAATTTTAGGACCAATCGGCATCCCTGGACGCCCT
GGTGAAGAAGGACCCCAAGGACCACCTGGAGAGCCTGGTG
ACAAAGGAGACATGGGAGAGCGTGGTATCCGAGGGCCTCA
GGGAGTGGTCGGAAAGAAGGGAGATAATGGACTTCCAGGA
ATTGATGGAAAAGATGGCACTCCTGGCATCCCCGGGATAA
AGGGTGCTGCAGGACAAAACGGAAGACCTGGAGCTCCTGG
CAATCAAGGAGATCCTGGTTTGCCTGGTATGCCTGGAGCC
AAAGGTGAAGTGGGGGTTAAGGGTGAGACCGGACCCCGGG
GTTTGATGGGAATGCAAGGATCCCCAGGACCGCAAGGAGA
ACCTGGTCCTCCAGGTGAAGCTGGCATGGAGGGAGTCCCG
GGGGCAAAGGGTGACAGAGGTGAACGAGGACCAGTCGGCC
CTGCTGGGGTTATTGGTTTGCCTGGCAGTAAAGGAGAAAG
GGGGCCCATGGGGGTCCCAGGAGCTCAGGGTCTAACTGGA
ACTAAGGGTGATAAGGGATTCCAAGGCAAAGTGGGATCAA
AAGGAGACGTCGGTGATCCCGGTGTGGAGGGATTGGCTGG
GGAGAAAGGAGAGAAGGGACAGTCTGGGGAGCCTGGGCCT
AAGGGACAGCAAGGTGTGACAGGTGATCAAGGGTCCAATG
GGCCTACTGGAGATCCCGGTAAACCAGGAGACCAGGGTCC
CGCAGGCTTACCTGGCCCACGTGGCCTTGGTGGAGAAAGA
GGAATTCCAGGGATGCCAGGAATACAAGGACCAGCTGGTC
GTGATGCTTCAGATCAACACATCATTGACGTGGTTCTGAA
GATGCTTCAAGAGAGGTTAGCAGCAGTAGCAATGAGTGCT
AAGAGAGCCGTGCTGGGTGGAGCAGGTGTAATGGGACCTC
CTGGTCCTCCAGGACCACCAGGGCCTCCTGGACCGCAAGG
TCCTCATGGCCTGACAGGTGGCCGTGGCATTCCTGGAATC
ATTGGTGCCCCAGGCCAGATAGGAAACACTGGGCTAAAAG
GGAAGAGGGGTGCTAAGGGAGAAAGGGGAGATCCTGGGCG
ACCACATCCTGGACAACCAGGACCACCTGGACTGCCAGGT
CCTCCTGGTCTTGATGGTGTGGCACGTGATGGTAGGCCAG
GTGAGCGAGGACCTCAGGGGGCAGCAGGTGAGGCAGGCCG
TCCCGGAAAGGCTGGTCCTCCTGGTCTTCCTGGATTTTGT
GAAGCAGCTGCTTGTTTGGCAGCCTCTGCCTACACTTCTC
CCAGACTACAAGAAGCGGGAACAGTGAAGGGCCCGTCCAC
TTAAATCAAGCCCCTTTACTGGGGCCTAGGAACATCTGAG
AGAAAGTCAGAAAGAAATAAAGAGGGACAGAAGGCACACA
AAAAGAGTGGCACACATGCCTTTTCTTCATTGGACAAATT
GTGAGGGGGGAGGGAACAGCCGTTGACTGACATTTGATTA
TTAGGAGTGTACATGAATGAATTGACATGTATGGAAAGCA
AGTTTTACAGTAAGTTGGCCATGTTAGCTGCTGCTGCTCT
GTCCCACCTCACAGTACAGAGAGATGTGAGTATATTGCCA
GTGACATCACACCAACGGACCAGAAGAACTGCAAGAATGA
CAATCAAACAAAGGTGCTGTTTTTGTTAGTGTTTCATTTT
CGTTTTAAATGCATCTGATGATGCCAAGGTTTTTACATGC
CAGGAAATTTCCCCATGAACCAATAAAAATGTATGCAAAG
CTACTTTAATAATCAAAATCGATACCTCATTTGGACATTA
CTTCTTAGTTTGTACTGTGCCCGTCTCCGCCATGAAGAAG
CGCCCTGATCTGTTCTTCTCATTGAGATGCCGACGTTCTT
CCAATAACGTTATCCTTGATTCCATGCTGTAAATCTTTGT
AAATGTGTGTTAATTTTGTATGGACAGGGTGGTTTTAGAA
TATAAAGCAGATCTAGGTTAATGAATTTAATCAGCAGTAC
TCAAACAATGCTCAGATTTCATCTGGTGAATTAGAAACAT
GTACACCAATTCCAAGTTACTTTGGGTTGTGTTCTTAGAG
AAGAACTGATTATCTTCATTAACAAACTATTTATTGTTCT
TTTTTGTCTGTAAACTCAAGTTGTTTTGCCAGGTTGTTCA
GGTTTACCCCAATCAATAAAAAAGAACGTTTTGTAAAACT
CAA

col9a2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col9a2-201 3163
ncRNA col9a2-002 (1) 720
col9a2-003 (1) 823
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col9a2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000020604 (1),  Ensembl_Trans:ENSDART00000035093 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY113700 (1) 3178 bp
GenBank:BC078424 (1) 2250 bp
GenBank:CK140813 (1) 789 bp
GenBank:DR717443 (1) 758 bp
GenBank:BQ826565 (1) 649 bp
GenBank:CD777917 (1) 619 bp
GenBank:CR927530 (1) 539 bp
GenBank:BQ826566 (1) 510 bp
GenBank:AI958567 (1) 477 bp
GenBank:CK675443 (1) 459 bp
GenBank:AA494929 (1) 437 bp
CITATIONS (2)