Transcript

col9a2-201

ID
ZDB-TSCRIPT-090929-4818
Name
col9a2-201
Previous Names
  • col9a2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020604 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020604|OTTDARG00000017093|ZDB-GENE-030131-9786 col9a2|OTTDARP00000017403 col9a2-001 LG_ BX276085.8 Danio rerio protein_coding KNOWN, 3163 bp
GGGGCTGGCTGTAGGGCTGGGTTACACCTCTCTCATTCCT
CCCCTCAAGTCTCTGCCACTGTGTTTTTCTTCCCCGTCCT
GGGCACAGCACACACGCTCACACACACCTCTCCTTTTTCC
CTGAATCCACCATCCTGGGCTGAGAAGCCAGGAGAGAGGG
TGGCAAGGTTTGGAGGAACCGTTGGATTTTGGATAGTGAA
TCTTCACCATGGCTGAGTTCTTCATCGTCCTCAGGAGTTT
GGTTCTGCTGCAGGTCCTCTGCTTGGCCTTATCGCAAGTG
ACCGGTCCACCCGGAGCTCAAGGCCCCGCTGGTTCCCCTG
GTCCTGCTGGAACTCCCGGAGCCGACGGCATTGATGGTGA
GAAGGGACCCCCTGGACCTCCTGGACCAAGAGGTCAAAAG
GGAGAGTCGGGTGAGCCTGGGCCTGATGGACCCCCGGGTG
AAGATGGCATTGATGGTTTGATTGGGGCGAAAGGTGAGAG
GGGTCCTCGTGGTAATCCTGGACCAAAGGGTCAGCCAGGG
CCTAGAGGACCAGCAGGACGACCTGGACCTGGACTGCCTG
GACTTCCTGGAGCAGCAGGGCCCATTGGGCTTCCTGGACA
AATTGGACCTACAGGACCAAAGGGTGTCATGGGAAGTCCC
GGACCTTCAGGATTACCAGGACCTCCAGGCAAGCCTGGTC
CACCAGGGAAGTTTTTGGGTCTAGAGGAAGGCAGCGCCGA
CTTTCAGTGTCCAACCAACTGTCCACCGGGACCAAAGGGT
CCTCAGGGCCTGCAGGGAGTCAAGGGACACAAAGGTCGTT
CTGGGGTGTTGGGAGATCCAGGAAGCATCGGAAAAACGGG
TATAAAAGGTGAAGTTGGCATCTCCGGTGAACAAGGGATC
CCAGGCCCTCCAGGCCCTCAGGGTCTGAGAGGGTATCCAG
GAATGGTGGGGCCAAAAGGCGAGACGGGACCACAAGGTTA
TAAAGGAATTTTAGGACCAATCGGCATCCCTGGACGCCCT
GGTGAAGAAGGACCCCAAGGACCACCTGGAGAGCCTGGTG
ACAAAGGAGACATGGGAGAGCGTGGTATCCGAGGGCCTCA
GGGAGTGGTCGGAAAGAAGGGAGATAATGGACTTCCAGGA
ATTGATGGAAAAGATGGCACTCCTGGCATCCCCGGGATAA
AGGGTGCTGCAGGACAAAACGGAAGACCTGGAGCTCCTGG
CAATCAAGGAGATCCTGGTTTGCCTGGTATGCCTGGAGCC
AAAGGTGAAGTGGGGGTTAAGGGTGAGACCGGACCCCGGG
GTTTGATGGGAATGCAAGGATCCCCAGGACCGCAAGGAGA
ACCTGGTCCTCCAGGTGAAGCTGGCATGGAGGGAGTCCCG
GGGGCAAAGGGTGACAGAGGTGAACGAGGACCAGTCGGCC
CTGCTGGGGTTATTGGTTTGCCTGGCAGTAAAGGAGAAAG
GGGGCCCATGGGGGTCCCAGGAGCTCAGGGTCTAACTGGA
ACTAAGGGTGATAAGGGATTCCAAGGCAAAGTGGGATCAA
AAGGAGACGTCGGTGATCCCGGTGTGGAGGGATTGGCTGG
GGAGAAAGGAGAGAAGGGACAGTCTGGGGAGCCTGGGCCT
AAGGGACAGCAAGGTGTGACAGGTGATCAAGGGTCCAATG
GGCCTACTGGAGATCCCGGTAAACCAGGAGACCAGGGTCC
CGCAGGCTTACCTGGCCCACGTGGCCTTGGTGGAGAAAGA
GGAATTCCAGGGATGCCAGGAATACAAGGACCAGCTGGTC
GTGATGCTTCAGATCAACACATCATTGACGTGGTTCTGAA
GATGCTTCAAGAGAGGTTAGCAGCAGTAGCAATGAGTGCT
AAGAGAGCCGTGCTGGGTGGAGCAGGTGTAATGGGACCTC
CTGGTCCTCCAGGACCACCAGGGCCTCCTGGACCGCAAGG
TCCTCATGGCCTGACAGGTGGCCGTGGCATTCCTGGAATC
ATTGGTGCCCCAGGCCAGATAGGAAACACTGGGCTAAAAG
GGAAGAGGGGTGCTAAGGGAGAAAGGGGAGATCCTGGGCG
ACCACATCCTGGACAACCAGGACCACCTGGACTGCCAGGT
CCTCCTGGTCTTGATGGTGTGGCACGTGATGGTAGGCCAG
GTGAGCGAGGACCTCAGGGGGCAGCAGGTGAGGCAGGCCG
TCCCGGAAAGGCTGGTCCTCCTGGTCTTCCTGGATTTTGT
GAAGCAGCTGCTTGTTTGGCAGCCTCTGCCTACACTTCTC
CCAGACTACAAGAAGCGGGAACAGTGAAGGGCCCGTCCAC
TTAAATCAAGCCCCTTTACTGGGGCCTAGGAACATCTGAG
AGAAAGTCAGAAAGAAATAAAGAGGGACAGAAGGCACACA
AAAAGAGTGGCACACATGCCTTTTCTTCATTGGACAAATT
GTGAGGGGGGAGGGAACAGCCGTTGACTGACATTTGATTA
TTAGGAGTGTACATGAATGAATTGACATGTATGGAAAGCA
AGTTTTACAGTAAGTTGGCCATGTTAGCTGCTGCTGCTCT
GTCCCACCTCACAGTACAGAGAGATGTGAGTATATTGCCA
GTGACATCACACCAACGGACCAGAAGAACTGCAAGAATGA
CAATCAAACAAAGGTGCTGTTTTTGTTAGTGTTTCATTTT
CGTTTTAAATGCATCTGATGATGCCAAGGTTTTTACATGC
CAGGAAATTTCCCCATGAACCAATAAAAATGTATGCAAAG
CTACTTTAATAATCAAAATCGATACCTCATTTGGACATTA
CTTCTTAGTTTGTACTGTGCCCGTCTCCGCCATGAAGAAG
CGCCCTGATCTGTTCTTCTCATTGAGATGCCGACGTTCTT
CCAATAACGTTATCCTTGATTCCATGCTGTAAATCTTTGT
AAATGTGTGTTAATTTTGTATGGACAGGGTGGTTTTAGAA
TATAAAGCAGATCTAGGTTAATGAATTTAATCAGCAGTAC
TCAAACAATGCTCAGATTTCATCTGGTGAATTAGAAACAT
GTACACCAATTCCAAGTTACTTTGGGTTGTGTTCTTAGAG
AAGAACTGATTATCTTCATTAACAAACTATTTATTGTTCT
TTTTTGTCTGTAAACTCAAGTTGTTTTGCCAGGTTGTTCA
GGTTTACCCCAATCAATAAAAAAGAACGTTTTGTAAAACT
CAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations