header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11651
Transcript Name: col9a2-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029229 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029229|OTTDARG00000017093|ZDB-GENE-030131-9786 col9a2|no_translation col9a2-003 LG_ BX276085.8 Danio rerio protein_coding KNOWN, 823 bp
GGCAGCAACCTAGCTTTCCCATATGGTCTCCGATCCAGGT
ACTGACCGGGTGCAGCCCTGCTTAGCTTCACTGAGCAGAA
TAGTGTCCCTGTCGCTATAAAGGGGCATTAGGACCCACAC
AGACCTCAGGTTAGGCGGCCCCTCGCTGGCCTCGCTAACG
CCACTTCCGGCAGCAACCTAGCTTTCACATGTGGTCTCTG
ATCTAGGTACTGACCGGGCGCAGACCTGCTTAGCTTCAGT
GGGCGACCATGTAAGAGTTGCAGAGAGCTAACTGGCGGCC
ATACACTGTCCAGAATCTCTACAGAAGTTGCAATCAATCT
AATCTTAACAATTTTAAAAGAACTAATTTTCATGTTTCTG
TATTCCTCTGACAGAGAGGTTAGCAGCAGTAGCAATGAGT
GCTAAGAGAGCCGTGCTGGGTGGAGCAGGTGTAATGGGAC
CTCCTGGTCCTCCAGGACCACCAGGGCCTCCTGGACCGCA
AGGTCCTCATGGCCTGACAGGTGGCCGTGGCATTCCTGGA
ATCATTGGTGCCCCAGGCCAGATAGGAAACACTGGGCTAA
AAGGGAAGAGGGGTGCTAAGGGAGAAAGGGGAGATCCTGG
GCGACCACATCCTGGACAACCAGGACCACCTGGACTGCCA
GGTCCTCCTGGTCTTGATGGTGTGGCACGTGATGGTAGGC
CAGGTGAGCGAGGACCTCAGGGGGCAGCAGGTGAGGCAGG
CCGTCCCGGAAAGGCTGGTCCTCCTGGTCTTCCTGGATTT
TGTGAAGCAGCTGCTTGTTTGGCAGCCTCTGCCTACACTT
CTCCCAGACTACAAGAAGCGGGA

col9a2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col9a2-201 (1)    Ensembl 3163
ncRNA col9a2-002 (1) 720
col9a2-003 823
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col9a2-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029229 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE701275 (1) 838 bp
CITATIONS (1)