Community Action Needed: Please respond to the NIH RFI
Transcript

col9a2-002

ID
ZDB-TSCRIPT-090929-11650
Name
col9a2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029228 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029228|OTTDARG00000017093|ZDB-GENE-030131-9786 col9a2|no_translation col9a2-002 LG_ BX276085.8 Danio rerio protein_coding KNOWN, 720 bp
GGGGCTGGCTGTAGGGCTGGGTTACACCTCTCTCATTCCT
CCCCTCAAGTCTCTGCCACTGTGTTTTTCTTCCCCGTCCT
GGGCACAGCACACACGCTCACACACACCTCTCCTTTTTCC
CTGAATCCACCATCCTGGGCTGAGAAGCCAGGAGAGAGGG
TGGCAAGGTTTGGAGGAACCGTTGGATTTTGGATAGTGAA
TCTTCACCATGGCTGAGTTCTTCATCGTCCTCAGGAGTTT
GGTTCTGCTGCAGGTCCTCTGCTTGGCCTTATCGCAAGTG
ACCGGTCCACCCGGAGCTCAAGGCCCCGCTGGTTCCCCTG
GTCCTGCTGGAACTCCCGGAGCCGACGGCATTGATGGTGA
GAAGGGACCCCCTGGACCTCCTGGACCAAGAGTAAGTAGT
GATCAGAATTGGACTTTATTTTTTTTAACTAATCCAGTAC
TGCATTTCTGAAATAATTCAAATTAGTTTATTTTGTTGCT
CAAGAATCTTGTTTTGGTACTGGCAGTGTTGAAAACAATG
TTCTGCTGCTTAATGTTTTGTGCAAAGCATGGTACATAAT
GCTTCGTGAGTAGAACAATAAAAAGAGCATCACAAACAGA
AAAGTTCAAATATGGTCAAATATGGTAAATATCCTTGCTG
ATTAAAGGGTAATGTGTTAATTTAATTTGAATAATTTATG
CAATAAAACCAAATTCATCTAATTATTTTGTATACTCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations