ZFIN ID: ZDB-TSCRIPT-090929-14981
Transcript Name: ska3-201
Previous Names: ska3-003, si:rp71-68n21.13-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034078 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034078|OTTDARG00000025807|ZDB-GENE-030131-2997 ska3|OTTDARP00000027505 RP71-68N21.13-003 LG_ BX511129.15 Danio rerio protein_coding NOVEL, 964 bp
ACTAACCCGGATGGACCGCGAAATTTCAAACAAGAGCTCA
GAGTGTTTGCTTAAATGTTTGTGATGAGCCTGTACCATTA
AGCATGAATCCGTCAGAGCGATTTTTCTCGAAGCTGCGAA
AGCTCACCGTGTATCTGGAGACTGAAAGCAGTAGCCTCTT
GCATACAAGCCAGAACCTCAAAGAGGACGAGGAGGATGAA
GAGACTGGAGCTCAAGCACTGTATCAGCTGCACTCTGAAG
TCAGAGCACTAAAGAGGCAAGTTAGGGATCAGGTGGCTAC
CCATGATACAAGCAGTGCTGACCTGAGGAGCTTCATCAGA
AGATGTTTGGTGCTGAAGCAGAGAACCACAGAAGACATTG
ACAGTCTGAAGAAACACTATGAGAAATATGGTTACAGGCC
ACGGATATCAAGACTGGGAAGTGCAGAGGTGAATGGTACA
AAAGAAGCAGAGGAGCGTGCAAAGAGAGATGCAGAAAAGC
CAGATGCAGAAGAGGAAGATGAAGAGACGGAACGTGGAGA
TTGTGACAAGTTTCAGAGAGTGCTTGGTGAAGCAGAGGTC
CCACTGAGTGCTGCTCCTGAGCCTGCCATCGCTCTGTCAT
CTCCACCAATCCTCATGAACCTGCAGCCTCCGCAGCCAAA
GACACCCAAGTGCTCGCTGAGTATGGAGGAGGACGCTCTG
ACCCCACGACTGGAGGACTTTGGCATCTCTGAGTACACCA
TGTGCTGGAACAATGATTTCACCATGGATTTGTTCAACAA
GAAGCCACCAAAGAACAGCAGCGAAAGAAATGAAAATGTT
CTGAAACCCCATAACGTATTCTCCAATACATCATCTGTGC
TGAACAAAGACGTTGCTAACAAAAGTCTCGAATCCCCGGA
GCCTCCAGAGTTTTGCACCCCAGGATTTAAGATTGCGAAA
AACCACGTCCCATCTACTCCACTATTCAATGGAAAGAATG
ATCT

ska3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ska3-201 964
ska3-202 (1)    Ensembl 1801
ska3-203 (1)    Ensembl 856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ska3-201 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000034078 (1),  Ensembl_Trans:ENSDART00000132324 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH501612 (1) 994 bp
CITATIONS (2)