ZFIN ID: ZDB-TSCRIPT-090929-14980
Transcript Name: ska3-203
Previous Names: ska3-002, si:rp71-68n21.13-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034077 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034077|OTTDARG00000025807|ZDB-GENE-030131-2997 ska3|OTTDARP00000027504 RP71-68N21.13-002 LG_ BX511129.15 Danio rerio protein_coding NOVEL, 856 bp
TAACTGCTATTTCAGCCTGTACCATTAAGCATGAATCCGT
CAGAGCGATTTTTCTCGAAGCTGCGAAAGCTCACCGTGTA
TCTGGAGACTGAAAGCAGTAGCCTCTTGCATACAAGCCAG
AACCTCAAAGAGGACGAGGAGGATGAAGAGACTGGAGCTC
AAGCACTGTATCAGCTGCACTCTGAAGTCAGAGCACTAAA
GAGGCAAGTTAGGGATCAGGTGGCTACCCATGATACAAGC
AGTGCTGACCTGAGGAGCTTCATCAGAAGATGTTTGGTGC
TGAAGCAGAGAACCACAGAAGACATTGACAGTCTGAAGAA
ACACTATGAGAAATATGGTTACAGGCCACGGATATCAAGA
CTGGGAAGTGCAGAGGTGAATGGTACAAAAGAAGCAGAGG
AGCGTGCAAAGAGAGATGCAGAAAAGCCAGATGCAGAAGA
GGAAGATGAAGAGACGGAACGTGGAGATTGTGACAAGGTT
GATCAGTCAGTGACCCCTGAGAAGATGCCTCCACCTGTTG
ACCAGCTGCAGACACCAAAGCTGTCAGATTTTGGCCTGTC
TGCACTCCAGTTTCAGAGAGTGCTTGGTGAAGCAGAGGTC
CCACTGAGTGCTGCTCCTGAGCCTGCCATCGCTCTGTCAT
CTCCACCAATCCTCATGAACCTGCAGCCTCCGCAGCCAAA
GACACCCAAGTGCTCGCTGAGTATGGAGGAGGACGCTCTG
ACCCCACGACTGGAGGACTTTGGCATCTCTGAGTACACCA
TGTGCTGGAACAATGATTTCACCATGGATTTGTTCAACAA
GAAGCCACCAAAGAACAGCAGCGAAAGAAATGAAAATGTT
CTGAAACCCCATAACG

ska3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ska3-201 (1)    Ensembl 964
ska3-202 (1)    Ensembl 1801
ska3-203 856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ska3-203 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000034077 (1),  Ensembl_Trans:ENSDART00000145943 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH453074 (1) 899 bp
CITATIONS (2)