header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14979
Transcript Name: ska3-202
Previous Names: ska3-001, si:rp71-68n21.13-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034076 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034076|OTTDARG00000025807|ZDB-GENE-030131-2997 ska3|OTTDARP00000027503 RP71-68N21.13-001 LG_ BX511129.15 Danio rerio protein_coding NOVEL, 1801 bp
GTGTTTAGATCGTTTCAGACGTGCAAACGAGTTAGAAAAA
CTAACCCGGATGGACCGCGAAATTTCAAACAAGAGCTCAG
AGTGTTTGCTTAAATGTTTGTGATGAGCCTGTACCATTAA
GCATGAATCCGTCAGAGCGATTTTTCTCGAAGCTGCGAAA
GCTCACCGTGTATCTGGAGACTGAAAGCAGTAGCCTCTTG
CATACAAGCCAGAACCTCAAAGAGGACGAGGAGGATGAAG
AGACTGGAGCTCAAGCACTGTATCAGCTGCACTCTGAAGT
CAGAGCACTAAAGAGGCAAGTTAGGGATCAGGTGGCTACC
CATGATACAAGCAGTGCTGACCTGAGGAGCTTCATCAGAA
GATGTTTGGTGCTGAAGCAGAGAACCACAGAAGACATTGA
CAGTCTGAAGAAACACTATGAGAAATATGGTTACAGGCCA
CGGATATCAAGACTGGGAAGTGCAGAGGTGAATGGTACAA
AAGAAGCAGAGGAGCGTGCAAAGAGAGATGCAGAAAAGCC
AGATGCAGAAGAGGAAGATGAAGAGACGGAACGTGGAGAT
TGTGACAAGGTTGATCAGTCAGTGACCCCTGAGAAGATGC
CTCCACCTGTTGACCAGCTGCAGACACCAAAGCTGTCAGA
TTTTGGCCTGTCTGCACTCCAGTTTCAGAGAGTGCTTGGT
GAAGCAGAGGTCCCACTGAGTGCTGCTCCTGAGCCTGCCA
TCGCTCTGTCATCTCCACCAATCCTCATGAACCTGCAGCC
TCCGCAGCCAAAGACACCCAAGTGCTCGCTGAGTATGGAG
GAGGACGCTCTGACCCCACGACTGGAGGACTTTGGCATCT
CTGAGTACACCATGTGCTGGAACAATGATTTCACCATGGA
TTTGTTCAACAAGAAGCCACCAAAGAACAGCAGCGAAAGA
AATGAAAATGTTCTGAAACCCCATAACGTATTCTCCAATA
CATCATCTGTGCTGAACAAAGACGTTGCTAACAAAAGTCT
CGAATCCCCGGAGCCTCCAGAGTTTTGCACCCCAGGATTT
AAGATTGCGAAAAACCACGTCCCATCTACTCCACTATTCA
ATGGAAAGAATGATCTCAATTCTCCTCCTCGCCTCAATAA
TAACTGTCCTTCCACCCCAGAACTCCCTGCATTTGAAACC
CCTTTTGTCAGCAAGCTAATAAAAAAGGAGGACAGAGAGG
AAGAAAGCAAGAGGCACTCTGAATCACAGGAGAACAGTTT
GCGTCTACCAGATCTTTCAACCACAAATGGGACGTCTTGG
AATGATGCTCCTGAGATGCCAAAAATGTTACGTTATGAAG
AGGAAGCATTGCCTGAGATGCCGATCCTACAGTCTAATTT
TGGAAGTTCTCTAGCTTTTAAAAATACATCTGGTGAAAGT
CTCTCAGGGATGAAAACAGGAGCAGGTCATATGTTAGAAA
TGAAACAGACCTCTGTCCCAGTGCCTGAAGATGGATTCAA
CCAGGACTGGTGCCTTTCGACTCCGAAAGTCAGAGTGAAG
TTCCCAGCAGAGCCCTGCACACCAGAGATGCCTGATATGA
GCTCTGTCACTCAGGATATCTTAAAACTTGTGGCTCAGTG
CAAGTATTAAGCACTCACCACTGGATCTGTCCGGCAGACC
TCAAAACCTGGCTTTCAAAAAAGTGGCATCAGGAGGAGAA
CAGCAGTTTGAAGCCGTAACACAAAGGCTCTACTGACTTT
TTTATAATTACAAACACTTTTATTACGACTTGAAAAAAAC
TTAATAAATAATTTTAAAAAGCTTAAGTACAATTATAACA
A

ska3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ska3-201 (1)    Ensembl 964
ska3-202 1801
ska3-203 (1)    Ensembl 856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ska3-202 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034076 (1),  Ensembl_Trans:ENSDART00000137024 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC091849 (1) 1589 bp
GenBank:EH578587 (1) 906 bp
GenBank:CT597281 (1) 508 bp
GenBank:CK697909 (1) 381 bp
CITATIONS (2)