Transcript

dab2-203

ID
ZDB-TSCRIPT-090929-12629
Name
dab2-203
Previous Names
  • dab2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030410 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030410|OTTDARG00000023796|ZDB-GENE-040303-1 dab2|OTTDARP00000024782 dab2-003 LG_ BX510649.12 Danio rerio protein_coding KNOWN, 1723 bp
GAACATGTGGTGAATAAGATCTCCTTCATTGCTCGTGATG
TCACTGATAACCGGGCATTTGGCTATGTCTGTGGAGCAGA
GGGCCAGCATCAGTTTTTTGCTATTAAAACAGCTCAGCAG
GCTGAGCCTCTAGTCATTGATTTGAAGGATCTGTTTCAGT
TGATCTTTAATATGAAGAAGAAAGAGCAGGAGGCTGGACA
AAAGGGTGAAGGAAATGGCACTGAGAATGGTGGCGATGCT
TTACTCGCTGTGGATGGAAATGAAAACCCTGTAAAAAGTG
TAGAGCAGATGAACCTGTTTGGTGATATGTCCACTCCACC
TGACATTCATTCTCCTACGCCTGACAGTGTTCTGCTGCTT
GAGTTATCCGATTTGTTTGATGGCAATCAAGTAAATCAAG
ACAATCCTTTCATCACAAACCCATCTCCCCTCTGCAATAA
ACCATTTGACAAATCGGCTTCATCCACATCAGATCTTTTC
CCAACTCTGAGTTCAGATCCCTTCAGCGACGATCCCTTTT
CTCCCTTGAATGATCAATCAGATTCTGTGTTTTCCTCCAA
TAACGAGTCAGATTTTTCTAGTTTTCTTCTGAACGGGCCA
GACTCAAGTGAAGACCCCTCTCCAAAAAGTCAACAGTTCA
ATAAACTGTTTGATTCTCAGTTATCAAACGAGAGTCCAAA
TAATCAAGTACAGCAGCTACCGATAAGTGATCTGAATGGT
GGCACCAATTCCATCTTTAGTCAGAATCCTTTTTTGAGCA
TCTCATTGAACAACCCACCCATCGTAAATGGGTTATACAG
CTCAGATCCTCCTGTCCTCCAAGCTCCTCTGTGTAATGGA
TCCAATAAGCAATTGGCATTGTTCCAAACCAACCCCTCAA
CTACTGTTCAAAACGGAGGTTTGACAGCCCTCTGCCCTCC
ACCTCAAAACCTAAAGCCTAGATGTGCACGGAGGAGAGAG
AAGTCACCAGGAAATGACCTGTTTGGATCTGGACTGTTTG
CTCCACCTGCCCAAAATGAGTCTCAGGCATCAAATCAGAA
CGCCTCCATTCCAGCAGACCTGTTCAACTCCACACCATCC
TCCACCATCAATGCTTTTGGGTCCATGTCTCTTGGCCATG
CTCCTGGGACAGCTCCAGTCTCTTGGGGTCAGACACCCAC
AATGTTCCCCCCTCAGGCCGGTGTTCAGGTAACAATTCCA
GGACCTCCAAGACCTTTTCCTCAGCCGTCTGCCTTTGGAG
GCCTGTCTGCACCTGCATGGGGGCAGCAAGGAGCTTCGCC
TTTCGGTCCACCAGCTGGCACACAAGCCTGGGGTCAACCG
GGAGCCGCAGCACCTGTTGGGACGTGGCCTGCTCCTGGTC
CTGTGGCTAGTCCTTTCCAACCAAACCAGTTTGCTCCCAT
GATGCCTCCCAATGCCATGATGGGAATGCAGCAGGGTGCA
GTAGCTCCTCCTCGCCCTCCACCCCGTCCTCCAGTGAAAG
AAGAGCCCCCAGTGGTCAAAAGTGCCTTTACAGCTTTGGA
CCCCCTCGGGGAGAAGGAGAGTAAATCTGGAAAAGACATG
TTCAAAAATTTCCAGATGGTTAAACCCCAGAAACCTGAAC
CAGGGCCTGATCCAAACACCAATGGCTCATTTGATCAGTA
CTTTTCCAACAAGGTTGGCTTGGCTCAAGATGCAGCAGAT
CATGATGACTTTGAAATAAACCAAATCTCAGCTAACTCCA
ATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations