header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12629
Transcript Name: dab2-203
Previous Name: dab2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030410 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030410|OTTDARG00000023796|ZDB-GENE-040303-1 dab2|OTTDARP00000024782 dab2-003 LG_ BX510649.12 Danio rerio protein_coding KNOWN, 1723 bp
GAACATGTGGTGAATAAGATCTCCTTCATTGCTCGTGATG
TCACTGATAACCGGGCATTTGGCTATGTCTGTGGAGCAGA
GGGCCAGCATCAGTTTTTTGCTATTAAAACAGCTCAGCAG
GCTGAGCCTCTAGTCATTGATTTGAAGGATCTGTTTCAGT
TGATCTTTAATATGAAGAAGAAAGAGCAGGAGGCTGGACA
AAAGGGTGAAGGAAATGGCACTGAGAATGGTGGCGATGCT
TTACTCGCTGTGGATGGAAATGAAAACCCTGTAAAAAGTG
TAGAGCAGATGAACCTGTTTGGTGATATGTCCACTCCACC
TGACATTCATTCTCCTACGCCTGACAGTGTTCTGCTGCTT
GAGTTATCCGATTTGTTTGATGGCAATCAAGTAAATCAAG
ACAATCCTTTCATCACAAACCCATCTCCCCTCTGCAATAA
ACCATTTGACAAATCGGCTTCATCCACATCAGATCTTTTC
CCAACTCTGAGTTCAGATCCCTTCAGCGACGATCCCTTTT
CTCCCTTGAATGATCAATCAGATTCTGTGTTTTCCTCCAA
TAACGAGTCAGATTTTTCTAGTTTTCTTCTGAACGGGCCA
GACTCAAGTGAAGACCCCTCTCCAAAAAGTCAACAGTTCA
ATAAACTGTTTGATTCTCAGTTATCAAACGAGAGTCCAAA
TAATCAAGTACAGCAGCTACCGATAAGTGATCTGAATGGT
GGCACCAATTCCATCTTTAGTCAGAATCCTTTTTTGAGCA
TCTCATTGAACAACCCACCCATCGTAAATGGGTTATACAG
CTCAGATCCTCCTGTCCTCCAAGCTCCTCTGTGTAATGGA
TCCAATAAGCAATTGGCATTGTTCCAAACCAACCCCTCAA
CTACTGTTCAAAACGGAGGTTTGACAGCCCTCTGCCCTCC
ACCTCAAAACCTAAAGCCTAGATGTGCACGGAGGAGAGAG
AAGTCACCAGGAAATGACCTGTTTGGATCTGGACTGTTTG
CTCCACCTGCCCAAAATGAGTCTCAGGCATCAAATCAGAA
CGCCTCCATTCCAGCAGACCTGTTCAACTCCACACCATCC
TCCACCATCAATGCTTTTGGGTCCATGTCTCTTGGCCATG
CTCCTGGGACAGCTCCAGTCTCTTGGGGTCAGACACCCAC
AATGTTCCCCCCTCAGGCCGGTGTTCAGGTAACAATTCCA
GGACCTCCAAGACCTTTTCCTCAGCCGTCTGCCTTTGGAG
GCCTGTCTGCACCTGCATGGGGGCAGCAAGGAGCTTCGCC
TTTCGGTCCACCAGCTGGCACACAAGCCTGGGGTCAACCG
GGAGCCGCAGCACCTGTTGGGACGTGGCCTGCTCCTGGTC
CTGTGGCTAGTCCTTTCCAACCAAACCAGTTTGCTCCCAT
GATGCCTCCCAATGCCATGATGGGAATGCAGCAGGGTGCA
GTAGCTCCTCCTCGCCCTCCACCCCGTCCTCCAGTGAAAG
AAGAGCCCCCAGTGGTCAAAAGTGCCTTTACAGCTTTGGA
CCCCCTCGGGGAGAAGGAGAGTAAATCTGGAAAAGACATG
TTCAAAAATTTCCAGATGGTTAAACCCCAGAAACCTGAAC
CAGGGCCTGATCCAAACACCAATGGCTCATTTGATCAGTA
CTTTTCCAACAAGGTTGGCTTGGCTCAAGATGCAGCAGAT
CATGATGACTTTGAAATAAACCAAATCTCAGCTAACTCCA
ATG

dab2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA dab2-201 (1) 2444
dab2-203 1723
dab2-204 (1) 2336
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dab2-203 Contained in:
OTHER dab2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030410 (1)
  • Ensembl_Trans:ENSDART00000083862 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE306824 (1) 909bp
    GenBank:CR930447 (1) 534bp
    GenBank:CD589759 (1) 500bp
    CITATIONS (2)