Transcript

dab2-201

ID
ZDB-TSCRIPT-090929-12627
Name
dab2-201
Previous Names
  • dab2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030408 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030408|OTTDARG00000023796|ZDB-GENE-040303-1 dab2|OTTDARP00000024780 dab2-001 LG_ BX510649.12 Danio rerio protein_coding KNOWN, 2444 bp
GCGCTCGAGTCTCTGTCAGTGAGTTTGGTTTGAGGAGGCC
GAGGAGCGCCTGTCTCTGCTCAAAAGAGTGCTTTTGGTTT
CTCACTCATTCAAACTATCCACGCAGCTCATCTGCACCAT
CCTGAGTTTGTTATCATTGTTTCAGGCGCGGATTTCAATA
ATGCACGATTGCGGCCCAGCGCTGAGAATGTGTGCTTGCT
GAATATCCCACCTGTGTTTCCCCCCCTTCATTTTTGCCTC
TGGGCTGCTGTTTCCCCCCCCCTCCCACACTTTTTCTTTC
ATTTGTCCTGTAACAACCACTCACCATGTCACAGTCACCT
GAAGCAGAAACTGTTACTGTGGTACCAGCAGAACCAGCAT
CGACCACTGAATCAGCATCTGTCACAATAACCACTGCACC
CGTGACCAGAACTTCATTCTGGAAAGAAAGGAGAAAAATC
CCAGAGAAGACAGACGAGTTCCTCTTGGCCAGATTTCAGG
GTGATGGAGTGAGATATAAAGCCAAACTTATTGGTGTGGA
TGATGTTCAAGATGCAAGAGGGGATAAAATGTGTCAGGAT
TCCATGATGAAACTGAAGGGCATGGCAATAGCTGCTCGTT
CTCAAGGCAAGCACAAGCAAAGAATATGGATAAACATCTC
TTTAACAGGAATCAAAATTGTTGATGAGAAAACTGGGGTG
ATTGAGCATGAACATGTGGTGAATAAGATCTCCTTCATTG
CTCGTGATGTCACTGATAACCGGGCATTTGGCTATGTCTG
TGGAGCAGAGGGCCAGCATCAGTTTTTTGCTATTAAAACA
GCTCAGCAGGCTGAGCCTCTAGTCATTGATTTGAAGGATC
TGTTTCAGTTGATCTTTAATATGAAGAAGAAAGAGCAGGA
GGCTGGACAAAAGGGTGAAGGAAATGGCACTGAGAATGGT
GGCGATGCTTTACTCGCTGTGGATGGAAATGAAAACCCTG
TAAAAAGTGTAGAGCAGATGAACCTGTTTGGTGATATGTC
CACTCCACCTGACATTCATTCTCCTACGTCACCAGGAAAT
GACCTGTTTGGATCTGGACTGTTTGCTCCACCTGCCCAAA
ATGAGTCTCAGGCATCAAATCAGAACGCCTCCATTCCAGC
AGACCTGTTCAACTCCACACCATCCTCCACCATCAATGCT
TTTGGGTCCATGTCTCTTGGCCATGCTCCTGGGACAGCTC
CAGTCTCTTGGGGTCAGACACCCACAATGTTCCCCCCTCA
GGCCGGTGTTCAGGTAACAATTCCAGGACCTCCAAGACCT
TTTCCTCAGCCGTCTGCCTTTGGAGGCCTGTCTGCACCTG
CATGGGGGCAGCAAGGAGCTTCGCCTTTCGGTCCACCAGC
TGGCACACAAGCCTGGGGTCAACCGGGAGCCGCAGCACCT
GTTGGGACGTGGCCTGCTCCTGGTCCTGTGGCTAGTCCTT
TCCAACCAAACCAGTTTGCTCCCATGATGCCTCCCAATGC
CATGATGGGAATGCAGCAGGGTGCAGTAGCTCCTCCTCGC
CCTCCACCCCGTCCTCCAGTGAAAGAAGAGCCCCCAGTGG
TCAAAAGTGCCTTTACAGCTTTGGACCCCCTCGGGGAGAA
GGAGAGTAAATCTGGAAAAGACATGTTCAAAAATTTCCAG
ATGGTTAAACCCCAGAAACCTGAACCAGGGCCTGATCCAA
ACACCAATGGCTCATTTGATCAGTACTTTTCCAACAAGGT
TGGCTTGGCTCAAGATGCAGCAGATCATGATGACTTTGAA
ATAAACCAAATCTCAGCTAACTCCAATGGGACTTCCAAAC
CTGCTTCTCAGCTGATCCCTACTATGGATGCAATACCTCA
GGCAGCAGGTTTGATCCCAGCTCCAGCCACAGGGCTTTTG
GATGTGGCCTTCTCCTCAAATCCAGTCCCTGCACCCACAA
ACCCAGCTCCTGCAGCAGGCACAGATCTTTTTGATGACAC
TTTTGGAGTGAACCCATTTGGGGCACCACTCATGAACACA
AGCACTCCGGCCACTCAGAATGCTGCTCTTGCAGATGCTT
TTGGAGACCCGTTTGGGGGAAATCCCTTTGCCTGAAAGTT
ACCACTGCTGTACACTCCTGCTGACCCAGAGCTGCTGAGC
GAGAGGGCCACACAAGCACTGCAGCGTTCTACTACTTGGA
AAAGCACTGTTTAGAAAACTCTTGTATTCTGTGCTCTGCT
GTTCTCATTCACACTGTATATCTCCTGTAGTCTATTTCTG
TGCCTTTCTCACTGATCAACCCCAAGTCACATGTGAAATG
AGCTGCACAGTGAAGTAGCTGATGTAGGGTTGTAATTGAA
GGAAAGTAAAAAAAAAAAAAAATTCATGTTAATGGACATG
ATTTTCCTCTATGCAAGTATTCCTGTGCATTCATAATTAA
GTAAAATGCTTAATCCTAATTATTCATTAAAAAAGACAAA
TCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations