header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12628
Transcript Name: dab2-204
Previous Name: dab2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030409 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030409|OTTDARG00000023796|ZDB-GENE-040303-1 dab2|OTTDARP00000024781 dab2-002 LG_ BX510649.12 Danio rerio protein_coding KNOWN, 2336 bp
GGGTCATAAAAACATCACCGTTTTACCATATCAAGGGCAG
ATGAGCTGTTGGAAAAGGATTAACAAGTTTTAATTGCTCA
ACCTTTGATCAGTCCACCTTTGCTCTTGCTGTCTCGTTCC
TCTCTCTGCTGAGAAATACACAACTAAGCGTTGTTTTCTG
CTCATAAGGCCCAGCGCTGAGAATGTGTGCTTGCTGAATA
TCCCACCTGTGTTTCCCCCCCTTCATTTTTGCCTCTGGGC
TGCTGTTTCCCCCCCCCTCCCACACTTTTTCTTTCATTTG
TCCTGTAACAACCACTCACCATGTCACAGTCACCTGAAGC
AGAAACTGTTACTGTGGTACCAGCAGAACCAGCATCGACC
ACTGAATCAGCATCTGTCACAATAACCACTGCACCCGTGA
CCAGAACTTCATTCTGGAAAGAAAGGAGAAAAATCCCAGA
GAAGACAGACGAGTTCCTCTTGGCCAGATTTCAGGGTGAT
GGAGTGAGATATAAAGCCAAACTTATTGGTGTGGATGATG
TTCAAGATGCAAGAGGGGATAAAATGTGTCAGGATTCCAT
GATGAAACTGAAGGGCATGGCAATAGCTGCTCGTTCTCAA
GGCAAGCACAAGCAAAGAATATGGATAAACATCTCTTTAA
CAGGAATCAAAATTGTTGATGAGAAAACTGGGGTGATTGA
GCATGAACATGTGGTGAATAAGATCTCCTTCATTGCTCGT
GATGTCACTGATAACCGGGCATTTGGCTATGTCTGTGGAG
CAGAGGGCCAGCATCAGTTTTTTGCTATTAAAACAGCTCA
GCAGGCTGAGCCTCTAGTCATTGATTTGAAGGATCTGTTT
CAGTTGATCTTTAATATGAAGAAGAAAGAGCAGGAGGCTG
GACAAAAGGGTGAAGGAAATGGCACTGAGAATGGTGGCGA
TGCTTTACTCGCTGTGGATGGAAATGAAAACCCTGTAAAA
AGTGTAGAGCAGATGAACCTGTTTGGTGATATGTCCACTC
CACCTGACATTCATTCTCCTACGTCACCAGGAAATGACCT
GTTTGGATCTGGACTGTTTGCTCCACCTGCCCAAAATGAG
TCTCAGGCATCAAATCAGAACGCCTCCATTCCAGCAGACC
TGTTCAACTCCACACCATCCTCCACCATCAATGCTTTTGG
GTCCATGTCTCTTGGCCATGCTCCTGGGACAGCTCCAGTC
TCTTGGGGTCAGACACCCACAATGTTCCCCCCTCAGGCCG
GTGTTCAGGTAACAATTCCAGGACCTCCAAGACCTTTTCC
TCAGCCGTCTGCCTTTGGAGGCCTGTCTGCACCTGCATGG
GGGCAGCAAGGAGCTTCGCCTTTCGGTCCACCAGCTGGCA
CACAAGCCTGGGGTCAACCGGGAGCCGCAGCACCTGTTGG
GACGTGGCCTGCTCCTGGTCCTGTGGCTAGTCCTTTCCAA
CCAAACCAGTTTGCTCCCATGATGCCTCCCAATGCCATGA
TGGGAATGCAGCAGGGTGCAGTAGCTCCTCCTCGCCCTCC
ACCCCGTCCTCCAGTGAAAGAAGAGCCCCCAGTGGTCAAA
AGTGCCTTTACAGCTTTGGACCCCCTCGGGGAGAAGGAGA
GTAAATCTGGAAAAGACATGTTCAAAAATTTCCAGATGGT
TAAACCCCAGAAACCTGAACCAGGGCCTGATCCAAACACC
AATGGCTCATTTGATCAGTACTTTTCCAACAAGGTTGGCT
TGGCTCAAGATGCAGCAGATCATGATGACTTTGAAATAAA
CCAAATCTCAGCTAACTCCAATGGGACTTCCAAACCTGCT
TCTCAGCTGATCCCTACTATGGATGCAATACCTCAGGCAG
CAGGTTTGATCCCAGCTCCAGCCACAGGGCTTTTGGATGT
GGCCTTCTCCTCAAATCCAGTCCCTGCACCCACAAACCCA
GCTCCTGCAGCAGGCACAGATCTTTTTGATGACACTTTTG
GAGTGAACCCATTTGGGGCACCACTCATGAACACAAGCAC
TCCGGCCACTCAGAATGCTGCTCTTGCAGATGCTTTTGGA
GACCCGTTTGGGGGAAATCCCTTTGCCTGAAAGTTACCAC
TGCTGTACACTCCTGCTGACCCAGAGCTGCTGAGCGAGAG
GGCCACACAAGCACTGCAGCGTTCTACTACTTGGAAAAGC
ACTGTTTAGAAAACTCTTGTATTCTGTGCTCTGCTGTTCT
CATTCACACTGTATATCTCCTGTAGTCTATTTCTGTGCCT
TTCTCACTGATCAACCCCAAGTCACATGTGAAATGAGCTG
CACAGTGAAGTAGCTGATGTAGGGTTGTAATTGAAGGAAA
GTAAAAAAAAAAAAAA

dab2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA dab2-201 (1) 2444
dab2-203 (1) 1723
dab2-204 2336
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dab2-204 Contained in:
OTHER dab2-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030409 (1)
  • Ensembl_Trans:ENSDART00000139732 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY330222 (1) 2302bp
    GenBank:CD589964 (1) 500bp
    CITATIONS (2)