Transcript

eif4e1c-004

ID
ZDB-TSCRIPT-090929-11803
Name
eif4e1c-004
Previous Names
  • zgc:110154-004
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029408 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029408|OTTDARG00000022741|ZDB-GENE-050417-398 eif4e1c|no_translation DKEY-228D14.3-004 LG_ BX927098.24 Danio rerio protein_coding KNOWN, 196 bp
AGAATTTTCACAGGCAAGATGGCGACTTCGGAGCCGATGG
GCCCTCTGGTATTTCAAAAATGACAAGAGCAAAAGTTGGA
CAGAAAACCTGCGTCTCATCTCCAAGTTTGACACAGTGGA
AGATTTCTGGGCATTATACAATCACATACAACAGCCCAGT
AAGCTTGGATTTGGCTGTGATTACTGCTTATTTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations