Transcript

eif4e1c-203

ID
ZDB-TSCRIPT-090929-11802
Name
eif4e1c-203
Previous Names
  • eif4e1c-003
  • zgc:110154-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029407 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029407|OTTDARG00000022741|ZDB-GENE-050417-398 eif4e1c|OTTDARP00000024015 DKEY-228D14.3-003 LG_ BX927098.24 Danio rerio protein_coding KNOWN, 1005 bp
TCAGAAGAATTTTCACAGGCAAGATGGCGACTTCGGAGCC
GGTAAGAGGGATCGGGCTTGGTTCATTTAGGGCTTCCCAG
CTGCCAGAAATGCGAGGAACTGAAACTGAAGAAGTCCGCT
CTGATAGTCCTACGGCTGTTGTGACGACAAGTCCTGAACA
GTACATCAAACACCCTTTGCAAAACAGATGGGCCCTCTGG
TATTTCAAAAATGACAAGAGCAAAAGTTGGACAGAAAACC
TGCGTCTCATCTCCAAGTTTGACACAGTGGAAGATTTCTG
GGCATTATACAATCACATACAACAGCCCAGTAAGCTTGGA
TTTGGCTGTGATTACTGCTTATTTAAGGATGGTATTAAAC
CCATGTGGGAGGATGATAGGAATAAACTGGGTGGACGGTG
GTTAATGACCCTCAGCAAACAGCAACGGCACAACGACCTT
GACCGCTACTGGATGGAGACCCTGTTGTGTTTAATCGGAG
AGTCCTTTGACGAGGCCAGTGAAGATGTGTGTGGTGCTGT
TGTCAATGTCAGGCCAAAAGGGGATAAAATAGCCATTTGG
ACAGGCAACTGCCAAAACAGGGACGCAATCATGACGATAG
GGCAACAATACAAAGAGCGTTTGAGTCTCCCAAGCAAAAC
CCTCATCGGATACCAGTCACATGACGACACCTCTAGCAAA
AGCGGCTCTACAACAAAGAATATGTACTCTGTTTGAAGAA
AACTAATCTCAACTCATTGTAGGTTTATACAATTTCAAAT
TTGCATCACATTAATACTTTTCAGTTGTCAACTACTGTAG
TGTCCTTCCTTTTTAAGAAAAGAAAATAAAAAAAAAGTCA
AATGTAAATGTAGTGCTCTCCAGCCTGAATCGATCAGCAG
CGTCACCGTGTGGATCAGGCACCGTCTGCTTGTTTTAGAC
CTGAGAGAGGAGCGCCAGTTGAGCTAGACGTTACTGATAT
CATTTTAGCCATTCGGGAGAGTTTAAAAGGACTAATCCAG
ACTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations