header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11641
Transcript Name: col18a1a-201
Previous Name: col18a1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029218 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029218|OTTDARG00000022631|ZDB-GENE-030516-3 col18a1|OTTDARP00000023875 col18a1-003 LG_none BX927363.9,CT030212.9 Danio rerio protein_coding KNOWN, 5579 bp
CTGGCTTGTGGGCTGATTGTGGTGACTTTACGGTGAGCCA
GGGACGAGTCTGTCTGTACTCCTGAATGACTGCAAGTGAA
CATGATGGCTGAACTCAGGTTTTGGCTGTGCCTCTTTATT
TTGGCATGCGTGAGGATACGCCACACACATGGCTGGTTCT
GGTTTGATGACTCCAAGGAAATTGAGAAGGGCGTGCAGAC
ACCAGCATACCTGACCACCGTAGGGCCCACATCCCTGCCG
AGGACAGAACCATCCAGAACAACAGAAGAAAGTGGAGTGT
CGCTGTTGCAACTAATTGGCGATCCTCCACCCAACGGCGT
CTCCAAAGTCTTCGACCAAGCAAACAGTCCTGGATATGTG
TTTGGACCAAGCTCAAATGTGGGTCAGTCTGCTGCAGCCC
ACCTGCCCAATCCCTTCTACCGCGATTTCTCCCTCATCTT
CAATATAAAACCCACATCCTCCAAGCCTGGCGTGATCTTC
TCCATCACTGACCCCACTCAGAACATCATGTATGTTGGCG
TGAAGCTGTCGGCGGTGGAAAGAGGCAAACAGTCCATTAT
CTTCTACTACACCGAGCCTGATTCGCAGAGCTCCTATGAG
GCGGCCAGATTCTCTGTTTCCTCCATGTTGAACATATGGA
CGCGCTTTTCCATCAGCGTTTTGAACGAGCAGGTTTCTCT
CTACTTTAACTGCGACTCGGATCCTCAGGTTGTCAATTTC
GAGCGCTCGCCTGATGATATGGACATGGATGCTGGCGCTG
GAGTGTTTGTGGGACATGCCAGTGGAGCAGACCCGGATAA
GTTTTTGGGTGTTATTGGTGATCTGAGGGTGTCGAGAGAC
CCTGGGGCGGCTGAACGGCACTGTGAAGAAGAGGAGGATG
ACTATGCAACAGAGGCATCAGGTGATTACGGAGCAAGTGG
AGATGGAGAGCAGCCATCACCAGTTCAGCCAACACCTCCA
TCATCTCGGCCAATCCAGCGGCCACCGGTGATTAGCAGGG
ATCCTATACAGCGGCCACCGGTGATTAGCAGGGAGCCTAT
ACAGCAGACAGTTGCAAGAGGAGAGAAGGGTGACAGAGGG
GAGAAGGGTGCTAAAGGTGACAGGGGTCTTGCTGGGCCAA
AGGGTGATGTGGGGTCTGGATCAGTGTCTGGTGGAGGATC
AAAAGGAGACAAGGGCGTCCCAGGAGAGAAAGGAATGAAG
GGCACTTCTGGTTTTGGTTATCCTGGATCTAAGGGTGACC
GTGGCCCCCCTGGACCTCCAGGACCTCCGGGTCCCCAAGG
GCCCAGTGCAGAGGTAGAGGTGCGGGGCGATGGGTCAGTT
GTGCAGAAAGTCACAGGACCAAGAGGACCACCTGGACCCC
AAGGACCCCCTGGTCCCCCTGGACCTGAAGGGGAGCCGGG
TGACCCTGGTGAAGATGGAAAAGCTGGCCAAGTTGGACCT
TCTGGTTTTCCTGGAAATCCTGGGAATCCTGGACCCAAAG
GAGATAAGGGAGATCGAGGTGAAAGTCAGCCAGGACCCCG
TGGGCCGCCTGGTCCTCCCGGCCCACCAGGACCCTCCTCT
GGCTTTGATAGACCTACGTTTGTGGACATGGAGGGCTCTG
GATTTGATATGGACAGTGTGCGGGCAGTGCCTGGTTTGCC
TGGTCCACCTGGTCCTCCTGGTCCCCCTGGTCCCCCTGGC
TCTGCATCTTCAGGCTCTGGTGGTTTTGGGCCACCTGGTC
CTCCTGGGCAAAATGGGGCGCCAGGTCAGCCGGGACTTTC
GGGTGTACCAGGTGCTGATGGAAAACCAGGCTTACCTGGT
CCAAAAGGAGAGAAGGGTGATGCCGGTGAGCTGGGCCTTC
CTGGACCGGTGGGAGAGAAGGGTGCCAAAGGTTCTTCTGG
TCCCCCTGGCACCACTGGGATTGGTGGGCCTGCTGGTCTT
CCAGGACCAATTGGACCTATTGGACTTCCAGGACCACCTG
GTCCTCCTGGACCAAGCTTTAATGTTGGTTTTGATGACAT
GGAAGGTTCTGGTGTTCACTTCAGTTCAGTACCTGGAGTA
AGAGGACCAGTTGGAATCCCGGGGCCACCTGGTGTCCCAG
GGCCACAGGGTCAGCCTGGATTCCCAGGGCTTCCTGGTGA
GAAAGGCAGTTTAGGAGCTCAGGGAAATGATGGTCTTCCT
GGTGCAGATGGCTTCCCTGGACCACAGGGACCAAAGGGCG
ACAAAGGAGAGCGAGGCGACAGGGGTGAACCTGGTCGAGA
TGGACATGGTCATCCAGGCCAACCAGGCCCTCCTGGACCA
CCTGGACAGATTATTTATCGCTACTCTGAACATTATGATG
AAGTTGGAGGAACGGGGGCTCAGGGTGGTTCTGGTGTTCC
TGGCCAAGCAGGATTCCCAGGCCCAATGGGACCAAAGGGT
GACAGAGGTGAGCCTGGTCTTCCAGGCTATGACATTAAGG
GGGAGAAAGGAGAACCTGGACTTATTCTTGGACCTGATGG
AAATCCACTTTACCTTGGTGGATTGACAGGACAGAAGGGT
GAGAGAGGTATTTCTGGACCAGTCGGACCTCCTGGTCCAG
CAGGACCTCCTGGTGCAAAAGGTGAATTCGGAATGCCAGG
CAGACCTGGTCGTCCAGGTGTGAACGGATATAAAGGAGAG
AAGGGAGAGCCAAGTTCAGGCTCTGGATATGGTTACCCGG
GTCCCCCTGGTCCCCCAGGACCCCCTGGTCCCCCCGGACC
CGCTGTGCCCTTGGACAGATTTGGCAGATATGAAGATTAT
GCAAGGCTCTATCCAGCTACGAAAGGAGAGAAAGGAGACC
AAGGAGCTCCTGGCATTCCCGGATCGCCAGGTTTTTCCAC
AAACTTTGATATATATTCACTCAAGAATGAGATGAAGGGT
GAGCGGGGAGAGTCTGGTCTTAAAGGAGAGAAAGGAGAAC
CAGGAGGTGGATTTTATGACCCTCGTTTTGGAGCTGTACA
AGGACCACCAGGGAACCCAGGACCTGCTGGACCTAAAGGA
GACTCAATCAGAGGCCCACCTGGACCCCAGGGCCCACCAG
GAACACCCGGGGTTGGTTATGATGGTCGACCAGGTAATCC
AGGACCTCCTGGACCACCTGGTCCACCAGGGTCCCCATCA
CTGCCAGGACCCTATAGGCCACCACTCAGTATTCCTGGAC
CTCCAGGTCCTCCTGGCCCACCTGGAATTCCTGGCACTGG
ATCAGGGGTGACTGTCCTGAGGTCTCATGACATAATGATT
GCTACAGCACGCAGACAGACAGAAGGGACTCTGATTTACA
TTCTGGACAGAAACGATCTCTACCTCAGAGTTCGGGACGG
TGTTAGACAAGTGATGCTTGGGGATTATAAACCTCTTTAT
GGAGAGCTGGACAATGAAGTGGCAGCAGTCCAGCCACCCC
CTGTTGTTCACTATTCCCAGGACCACACGGCTAACAATGG
CGCAGAGCAGATTTCTCCACCACACCAGCCTATTGATTTC
CCAACGAGAGAGCAGGAGAACAGAAACCCCAACCCGCAAC
CTGACCCCCGATACCCGGATCCACGATACCCACCATACAC
TGACAACAGATACACCGATCCTGTAGAGCCCAACATCAGA
TATCCTGTTCAACCCGAGAGGAATCCAATCACTCCAGCCC
GCCGTCCTATCCCTCCTGTCAATCAGCCAGGAGGCCACGC
CCACACCCACACTTCCGGACCAGGGTTGCATCTTATTGCT
CTGAATTCTCCACAAGTGGGCAACATGAGAGGCATTCGCG
GGGCAGACTTCATGTGCTTCCAGCAGGCACGGGCCGTTGG
CATGAAGGGAACGTTCAGAGCCTTCCTGTCCTCCAAACTC
CAGGATCTCTACAGTATCGTCCGCAGATCTGACAGAGAGA
CATTACCAATTGTTAACCTAAAGGATCAAGTCCTCTTCAG
CAGCTGGGAGTCTCTCTTCAGTGACTCAGAGAGCAGGATG
AAGGACAATGCACCCATCTACTCGTTTGATGGCAGAGATG
TCCTGAGGGACAGTGCCTGGCCAGAGAAGATGATTTGGCA
CGGATCGGATGGCAGGGGTCACAGGCAAACGGATAACTAC
TGCGAGACATGGAGGGCCGGAGACCGCGCTGTCACAGGCC
TGGCCTCGTCCCTGCAGGCTGGTCAACTCCTCCAGCAGAC
CTCCAGCAGCTGCTCCAGCTCCTACATCGTGCTGTGCATC
GAGAACAGCTACATGACACAGTCCAAGAAATAAAGCCGTC
CGAAAGAGCCTTTGAAAACTCAACACTTCAGTCATACAGG
CCCAGATTTTGCTCCAGTAGATGCCTGTATCTAATGAATG
GAAATGTTAAAGAGTAAATTAAACTGAGTCTGCCTTAAGG
AGAATTTGCCAGTCATCTATTCGCCGTAACGCCAAAGGTT
GAACGTGGAGGTGTTTGCTCTTTCTCAGGGCACTGGCACA
TCTTTTTCAGGGGGTTAAACCAGAGAAGTGAGGCCAACTG
AGGCAGTTTTTTTTAACTGTATCCATATAAAATTTTGTAT
ATGAATTGTTTGTCTTCTGTGTTGTTGTTTTTTTTTTTTT
GAAAAATGTCTTAATTGGTATATTTAACCAATTTTAGCTA
TATTTTTTTGTGCAACCATTTTCCTTCAAGGTTATGTTGG
ATATCGAGGAGCAAACCTTGACATAGTTTTAGAATTTGAA
AAGAGAAAGTATTTATTTTGCAATAAAGAGAGCTAAAATA
TGATTTGAAACCACAAAGCATATTTGTTTGCTATTTTAGC
AAGCACATTTTTGCTACTTCAACAGATGTAAGACTGAAGT
GTAGCTTATAAATGGCTGCTCTCTAAAAACCTCTAGTGGG
CAAAGAGAAATGCCTTAAATAATTCAACGCTTACCCCTCA
AGAGTGTTTTGTACAAAACAAATGATTTGATCTGTTGCAT
CTATGGAATCACTGTGTTTTTTTTTTCTATTGTGATTAAT
GTGAAATTTCATATGGACATCTGAGTGTCATTATTTTACT
CTTCTGGTTGATTCCAGAAGTTTCCATGAGTAACGGGAAT
GGGAAGCTGAATAGTATTTGTAACAAATATTTTAAGGAAA
AAAATTCTGTTACTAAAAAATAGTGGTTACATGTCCCATA
ATTCAAAGGCATTGGTTGCATTCGGTGCTTTTTGCTGATG
AAACAGCTGCTGACAGTGTTGTTTGGGAGAGACAGATGTG
TTTTATGAAGACACTTTATCTTCTATCCATATGGAATTTC
AGACACCTAATCCACTCTAGTGCTACTGATGTGTTCAGCA
CAACCCTGTGGGCTTCTAGTCTTTTTTTCTTTCTTTCCTT
TTGTACTAGTATGTGCTGCATCATGTCTCGGAGGCACTGA
CATTTTTTATTTTTCATTAGCCACAATAATTTTGGCACCA
CTTCTTGTGTATTAAAATCTATTTCCTTAAAACCTACACA
TATCTTAGACTATGTTGTCTGTTCATGCACAATATTAACA
TATCGGATGTCGTTCACAAGCCATTTCATATCATGATTGT
TTACTGTTCACTGACTGTTTACTAAAAAAAAAAATAAAGG
TACATTTTTCCTCTTCAAA

col18a1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col18a1a-201 5579
col18a1a-202 (1)    Ensembl 5515
col18a1a-203 (1)    Ensembl 6365
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col18a1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029218 (1),  Ensembl_Trans:ENSDART00000007058 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AJ967005 (1) 3385 bp
CITATIONS (2)