header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11639
Transcript Name: col18a1a-203
Previous Name: col18a1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029216 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029216|OTTDARG00000022631|ZDB-GENE-030516-3 col18a1|OTTDARP00000023873 col18a1-001 LG_none BX927363.9,CT030212.9 Danio rerio protein_coding KNOWN, 6365 bp
CTGGCTTGTGGGCTGATTGTGGTGACTTTACGGTGAGCCA
GGGACGAGTCTGTCTGTACTCCTGAATGACTGCAAGTGAA
CATGATGGCTGAACTCAGGTTTTGGCTGTGCCTCTTTATT
TTGGCATGCGTGAGGATACGCCACACACATGGCTGGTTCT
GGTTTGATGACTCCAAGGAAATTGAGAAGGGCGTGCAGAC
ACCAGCATACCTGACCACCGTAGGGCCCACATCCCTGCCG
AGGACAGAACCATCCAGAACAACAGGTACAAGTGCTTCTG
TAACTGAAGAGGTCGCGAAAGAGGTCAGTTTTGAAGGGGA
ACCGGAGGTCAGATCCAGGTCTGGATTGGGGATTGAGTCC
GGATCCGGATCTGGATCATCCAGTTTTGAAAGACAGCATG
AATATTTAACATCATCCGACAAAATTTGGGGTATTATTGA
TGACAATTCTAGTTTGCATAATCAAGTGACCAAAGTGGAC
CAGACGGATGGACTTGACCCAGCAAACAGTCGATTTAATG
AAGGCGTTAATGTTTCTTTCACAAATATTACTGCTAAAAA
TAATGTAAATGAGAGTAATTTTGCAGAGCATGCTAACACG
ACGTTGTATTCCTCTGAATACGCTGTCTCAGATAATGCAC
TAACCATTGAAAGCCAATTTTTAATAGCCAGCATGCCAGC
ATCCTTCGAACCCCTGCGCTGCTTGCCGGTCGATTCTGGT
TTGCCGTTTTGCACCAGAAGGGGAGTGGAGAGTTTCTCTG
TGCCAAATTTTCTAAATCAAAGCAGCGTGGAGGAAGTTCG
GATGGTTTTGACCGAATGGGCATGGCTTTTGAGGTCAGGC
TGTCATCATAGTTTGGAATGGTTTTTCTGCCTGCTGTTGA
CCCCGCGGTGTGGCCACTCTGGATCTCTGCTGCCCTGTCG
CAGTTCTTGTGAGGTCCTGCAGGACAGTTGCTGGACACTC
CTGGACGAGGGCCGCCTCCCTGTGGAGTGCAAATCTCTGC
CTGAAGAGAAGCATGATGGGTATCGGTGCTTGTCAGTTAG
TAACCTGAAAGAAGAAAGTGGAGTGTCGCTGTTGCAACTA
ATTGGCGATCCTCCACCCAACGGCGTCTCCAAAGTCTTCG
ACCAAGCAAACAGTCCTGGATATGTGTTTGGACCAAGCTC
AAATGTGGGTCAGTCTGCTGCAGCCCACCTGCCCAATCCC
TTCTACCGCGATTTCTCCCTCATCTTCAATATAAAACCCA
CATCCTCCAAGCCTGGCGTGATCTTCTCCATCACTGACCC
CACTCAGAACATCATGTATGTTGGCGTGAAGCTGTCGGCG
GTGGAAAGAGGCAAACAGTCCATTATCTTCTACTACACCG
AGCCTGATTCGCAGAGCTCCTATGAGGCGGCCAGATTCTC
TGTTTCCTCCATGTTGAACATATGGACGCGCTTTTCCATC
AGCGTTTTGAACGAGCAGGTTTCTCTCTACTTTAACTGCG
ACTCGGATCCTCAGGTTGTCAATTTCGAGCGCTCGCCTGA
TGATATGGACATGGATGCTGGCGCTGGAGTGTTTGTGGGA
CATGCCAGTGGAGCAGACCCGGATAAGTTTTTGGGTGTTA
TTGGTGATCTGAGGGTGTCGAGAGACCCTGGGGCGGCTGA
ACGGCACTGTGAAGAAGAGGAGGATGACTATGCAACAGAG
GCATCAGGTGATTACGGAGCAAGTGGAGATGGAGAGCAGC
CATCACCAGTTCAGCCAACACCTCCATCATCTCGGCCAAT
CCAGCGGCCACCGGTGATTAGCAGGGATCCTATACAGCGG
CCACCGGTGATTAGCAGGGAGCCTATACAGCAGACAGTTG
CAAGAGGAGAGAAGGGTGACAGAGGGGAGAAGGGTGCTAA
AGGTGACAGGGGTCTTGCTGGGCCAAAGGGTGATGTGGGG
TCTGGATCAGTGTCTGGTGGAGGATCAAAAGGAGACAAGG
GCGTCCCAGGAGAGAAAGGAATGAAGGGCACTTCTGGTTT
TGGTTATCCTGGATCTAAGGGTGACCGTGGCCCCCCTGGA
CCTCCAGGACCTCCGGGTCCCCAAGGGCCCAGTGCAGAGG
TAGAGGTGCGGGGCGATGGGTCAGTTGTGCAGAAAGTCAC
AGGACCAAGAGGACCACCTGGACCCCAAGGACCCCCTGGT
CCCCCTGGACCTGAAGGGGAGCCGGGTGACCCTGGTGAAG
ATGGAAAAGCTGGCCAAGTTGGACCTTCTGGTTTTCCTGG
AAATCCTGGGAATCCTGGACCCAAAGGAGATAAGGGAGAT
CGAGGTGAAAGTCAGCCAGGACCCCGTGGGCCGCCTGGTC
CTCCCGGCCCACCAGGACCCTCCTCTGGCTTTGATAGACC
TACGTTTGTGGACATGGAGGGCTCTGGATTTGATATGGAC
AGTGTGCGGGCAGTGCCTGGTTTGCCTGGTCCACCTGGTC
CTCCTGGTCCCCCTGGTCCCCCTGGCTCTGCATCTTCAGG
CTCTGGTGGTTTTGGGCCACCTGGTCCTCCTGGGCAAAAT
GGGGCGCCAGGTCAGCCGGGACTTTCGGGTGTACCAGGTG
CTGATGGAAAACCAGGCTTACCTGGTCCAAAAGGAGAGAA
GGGTGATGCCGGTGAGCTGGGCCTTCCTGGACCGGTGGGA
GAGAAGGGTGCCAAAGGTTCTTCTGGTCCCCCTGGCACCA
CTGGGATTGGTGGGCCTGCTGGTCTTCCAGGACCAATTGG
ACCTATTGGACTTCCAGGACCACCTGGTCCTCCTGGACCA
AGCTTTAATGTTGGTTTTGATGACATGGAAGGTTCTGGTG
TTCACTTCAGTTCAGTACCTGGAGTAAGAGGACCAGTTGG
AATCCCGGGGCCACCTGGTGTCCCAGGGCCACAGGGTCAG
CCTGGATTCCCAGGGCTTCCTGGTGAGAAAGGCAGTTTAG
GAGCTCAGGGAAATGATGGTCTTCCTGGTGCAGATGGCTT
CCCTGGACCACAGGGACCAAAGGGCGACAAAGGAGAGCGA
GGCGACAGGGGTGAACCTGGTCGAGATGGACATGGTCATC
CAGGCCAACCAGGCCCTCCTGGACCACCTGGACAGATTAT
TTATCGCTACTCTGAACATTATGATGAAGTTGGAGGAACG
GGGGCTCAGGGTGGTTCTGGTGTTCCTGGCCAAGCAGGAT
TCCCAGGCCCAATGGGACCAAAGGGTGACAGAGGTGAGCC
TGGTCTTCCAGGCTATGACATTAAGGGGGAGAAAGGAGAA
CCTGGACTTATTCTTGGACCTGATGGAAATCCACTTTACC
TTGGTGGATTGACAGGACAGAAGGGTGAGAGAGGTATTTC
TGGACCAGTCGGACCTCCTGGTCCAGCAGGACCTCCTGGT
GCAAAAGGTGAATTCGGAATGCCAGGCAGACCTGGTCGTC
CAGGTGTGAACGGATATAAAGGAGAGAAGGGAGAGCCAAG
TTCAGGCTCTGGATATGGTTACCCGGGTCCCCCTGGTCCC
CCAGGACCCCCTGGTCCCCCCGGACCCGCTGTGCCCTTGG
ACAGATTTGGCAGATATGAAGATTATGCAAGGCTCTATCC
AGCTACGAAAGGAGAGAAAGGAGACCAAGGAGCTCCTGGC
ATTCCCGGATCGCCAGGTTTTTCCACAAACTTTGATATAT
ATTCACTCAAGAATGAGATGAAGGGTGAGCGGGGAGAGTC
TGGTCTTAAAGGAGAGAAAGGAGAACCAGGAGGTGGATTT
TATGACCCTCGTTTTGGAGCTGTACAAGGACCACCAGGGA
ACCCAGGACCTGCTGGACCTAAAGGAGACTCAATCAGAGG
CCCACCTGGACCCCAGGGCCCACCAGGAACACCCGGGGTT
GGTTATGATGGTCGACCAGGTAATCCAGGACCTCCTGGAC
CACCTGGTCCACCAGGGTCCCCATCACTGCCAGGACCCTA
TAGGCCACCACTCAGTATTCCTGGACCTCCAGGTCCTCCT
GGCCCACCTGGAATTCCTGGCACTGGATCAGGGGTGACTG
TCCTGAGGTCTCATGACATAATGATTGCTACAGCACGCAG
ACAGACAGAAGGGACTCTGATTTACATTCTGGACAGAAAC
GATCTCTACCTCAGAGTTCGGGACGGTGTTAGACAAGTGA
TGCTTGGGGATTATAAACCTCTTTATGGAGAGCTGGACAA
TGAAGTGGCAGCAGTCCAGCCACCCCCTGTTGTTCACTAT
TCCCAGGACCACACGGCTAACAATGGCGCAGAGCAGATTT
CTCCACCACACCAGCCTATTGATTTCCCAACGAGAGAGCA
GGAGAACAGAAACCCCAACCCGCAACCTGACCCCCGATAC
CCGGATCCACGATACCCACCATACACTGACAACAGATACA
CCGATCCTGTAGAGCCCAACATCAGATATCCTGTTCAACC
CGAGAGGAATCCAATCACTCCAGCCCGCCGTCCTATCCCT
CCTGTCAATCAGCCAGGAGGCCACGCCCACACCCACACTT
CCGGACCAGGGTTGCATCTTATTGCTCTGAATTCTCCACA
AGTGGGCAACATGAGAGGCATTCGCGGGGCAGACTTCATG
TGCTTCCAGCAGGCACGGGCCGTTGGCATGAAGGGAACGT
TCAGAGCCTTCCTGTCCTCCAAACTCCAGGATCTCTACAG
TATCGTCCGCAGATCTGACAGAGAGACATTACCAATTGTT
AACCTAAAGGATCAAGTCCTCTTCAGCAGCTGGGAGTCTC
TCTTCAGTGACTCAGAGAGCAGGATGAAGGACAATGCACC
CATCTACTCGTTTGATGGCAGAGATGTCCTGAGGGACAGT
GCCTGGCCAGAGAAGATGATTTGGCACGGATCGGATGGCA
GGGGTCACAGGCAAACGGATAACTACTGCGAGACATGGAG
GGCCGGAGACCGCGCTGTCACAGGCCTGGCCTCGTCCCTG
CAGGCTGGTCAACTCCTCCAGCAGACCTCCAGCAGCTGCT
CCAGCTCCTACATCGTGCTGTGCATCGAGAACAGCTACAT
GACACAGTCCAAGAAATAAAGCCGTCCGAAAGAGCCTTTG
AAAACTCAACACTTCAGTCATACAGGCCCAGATTTTGCTC
CAGTAGATGCCTGTATCTAATGAATGGAAATGTTAAAGAG
TAAATTAAACTGAGTCTGCCTTAAGGAGAATTTGCCAGTC
ATCTATTCGCCGTAACGCCAAAGGTTGAACGTGGAGGTGT
TTGCTCTTTCTCAGGGCACTGGCACATCTTTTTCAGGGGG
TTAAACCAGAGAAGTGAGGCCAACTGAGGCAGTTTTTTTT
AACTGTATCCATATAAAATTTTGTATATGAATTGTTTGTC
TTCTGTGTTGTTGTTTTTTTTTTTTTGAAAAATGTCTTAA
TTGGTATATTTAACCAATTTTAGCTATATTTTTTTGTGCA
ACCATTTTCCTTCAAGGTTATGTTGGATATCGAGGAGCAA
ACCTTGACATAGTTTTAGAATTTGAAAAGAGAAAGTATTT
ATTTTGCAATAAAGAGAGCTAAAATATGATTTGAAACCAC
AAAGCATATTTGTTTGCTATTTTAGCAAGCACATTTTTGC
TACTTCAACAGATGTAAGACTGAAGTGTAGCTTATAAATG
GCTGCTCTCTAAAAACCTCTAGTGGGCAAAGAGAAATGCC
TTAAATAATTCAACGCTTACCCCTCAAGAGTGTTTTGTAC
AAAACAAATGATTTGATCTGTTGCATCTATGGAATCACTG
TGTTTTTTTTTTCTATTGTGATTAATGTGAAATTTCATAT
GGACATCTGAGTGTCATTATTTTACTCTTCTGGTTGATTC
CAGAAGTTTCCATGAGTAACGGGAATGGGAAGCTGAATAG
TATTTGTAACAAATATTTTAAGGAAAAAAATTCTGTTACT
AAAAAATAGTGGTTACATGTCCCATAATTCAAAGGCATTG
GTTGCATTCGGTGCTTTTTGCTGATGAAACAGCTGCTGAC
AGTGTTGTTTGGGAGAGACAGATGTGTTTTATGAAGACAC
TTTATCTTCTATCCATATGGAATTTCAGACACCTAATCCA
CTCTAGTGCTACTGATGTGTTCAGCACAACCCTGTGGGCT
TCTAGTCTTTTTTTCTTTCTTTCCTTTTGTACTAGTATGT
GCTGCATCATGTCTCGGAGGCACTGACATTTTTTATTTTT
CATTAGCCACAATAATTTTGGCACCACTTCTTGTGTATTA
AAATCTATTTCCTTAAAACCTACACATATCTTAGACTATG
TTGTCTGTTCATGCACAATATTAACATATCGGATGTCGTT
CACAAGCCATTTCATATCATGATTGTTTACTGTTCACTGA
CTGTTTACTAAAAAAAAAAATAAAGGTACATTTTTCCTCT
TCAAA

col18a1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col18a1a-201 (1)    Ensembl 5579
col18a1a-202 (1)    Ensembl 5515
col18a1a-203 6365
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col18a1a-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029216 (1),  Ensembl_Trans:ENSDART00000130434 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AJ967006 (1) 4171 bp
GenBank:CT662727 (1) 883 bp
GenBank:EE320577 (1) 870 bp
GenBank:CT647352 (1) 788 bp
GenBank:CT728271 (1) 752 bp
GenBank:CT670479 (1) 751 bp
GenBank:CT636476 (1) 748 bp
GenBank:CT692888 (1) 743 bp
GenBank:CT590615 (1) 733 bp
GenBank:BQ258869 (1) 650 bp
GenBank:CT609863 (1) 615 bp
GenBank:AI942986 (1) 501 bp
GenBank:AI958663 (1) 491 bp
CITATIONS (2)