TALEN

TALEN1-hhex

ID
ZDB-TALEN-181008-1
Name
TALEN1-hhex
Previous Names
None
Target
Target Sequence 1
5' - ATCTGTCTCCGCCCGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl
Target Sequence 2
5' - CTCGCTGAGCTGCAGCATCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
s721 hhex
s722 hhex
Expression
Gene expression in Wild Types + TALEN1-hhex
No data available
Phenotype
Phenotype resulting from TALEN1-hhex
No data available
Phenotype of all Fish created by or utilizing TALEN1-hhex
Phenotype Fish Conditions Figures
liver prox1a expression decreased amount, abnormal hhexs721/s721 standard conditions Fig. 3 from Villasenor et al., 2019
common bile duct ab-2f11 labeling absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
extrahepatic duct malformed, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
liver sox9b expression absent, abnormal hhexs721/s721 standard conditions Fig. 3 from Villasenor et al., 2019
pancreatic A cell increased amount, abnormal hhexs721/s721 standard conditions Fig. S1 from Villasenor et al., 2019
digestive system duct absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
digestive system duct sox9b expression absent, abnormal hhexs721/s721 standard conditions Fig. 3 from Villasenor et al., 2019
intestinal bulb primordium ptf1a expression absent, abnormal hhexs721/s721 standard conditions Fig. 1 with image from Villasenor et al., 2019
extrapancreatic duct ab-2f11 labeling decreased amount, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
gall bladder ab-2f11 labeling absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
whole organism decreased life span, abnormal hhexs721/s721 standard conditions text only from Villasenor et al., 2019
extrapancreatic duct ab-2f11 labeling absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
gall bladder absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
cystic duct absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
anterior pancreatic bud prox1a expression decreased amount, abnormal hhexs721/s721 standard conditions Fig. 3 from Villasenor et al., 2019
exocrine pancreas ptf1a expression absent, abnormal hhexs721/s721 standard conditions Fig. 1 with image from Villasenor et al., 2019
digestive system duct hepaticobiliary system development decreased occurrence, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
anterior pancreatic bud sox9b expression absent, abnormal hhexs721/s721 standard conditions Fig. 3 from Villasenor et al., 2019
common bile duct absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
digestive system duct prox1a expression decreased amount, abnormal hhexs721/s721 standard conditions Fig. 3 from Villasenor et al., 2019
digestive system duct ab-2f11 labeling absent, abnormal hhexs721/s721 standard conditions Fig. 2 from Villasenor et al., 2019
primary islet cell ab-2f11 labeling mislocalised, abnormal hhexs721/s721 standard conditions Fig. S4 from Villasenor et al., 2019
pancreatic D cell decreased amount, abnormal hhexs721/s721 standard conditions Fig. S1 from Villasenor et al., 2019
endothelial cell ab7-prox1 labeling decreased amount, abnormal hhexs722/s722 standard conditions Fig. 3 with image from Gauvrit et al., 2018
whole organism hhex expression increased amount, abnormal hhexs722/s722 standard conditions Fig. S7 from Gauvrit et al., 2018
whole organism decreased life span, abnormal hhexs722/s722 standard conditions text only from Villasenor et al., 2019
posterior cardinal vein vegfc expression increased amount, abnormal hhexs722/s722 standard conditions Fig. 2 with image from Gauvrit et al., 2018
endothelial cell hhex expression increased amount, abnormal hhexs722/s722 standard conditions Fig. S4 with image from Gauvrit et al., 2018
intersegmental vessel absent, abnormal hhexs722/s722 standard conditions Fig. 4 with image from Gauvrit et al., 2018
posterior cardinal vein flt4 expression decreased amount, abnormal hhexs722/s722 standard conditions Fig. 2 with image from Gauvrit et al., 2018
somite endothelial cell decreased amount, abnormal hhexs722/s722 standard conditions Fig. 3 with image from Gauvrit et al., 2018
whole organism flt4 expression decreased amount, abnormal hhexs722/s722 standard conditions Fig. S7 from Gauvrit et al., 2018
whole organism vegfc expression increased amount, abnormal hhexs722/s722 standard conditions Fig. S7 from Gauvrit et al., 2018
thoracic duct intersegmental vessel absent, abnormal hhexs722/s722 standard conditions Fig. 4 with image from Gauvrit et al., 2018
whole organism prox1a expression decreased amount, abnormal hhexs722/s722 standard conditions Fig. S7 from Gauvrit et al., 2018
liver hypoplastic, abnormal hhexs721/s721; as3Tg standard conditions Fig. 1 with image from Villasenor et al., 2019
liver decreased size, abnormal hhexs721/s721; as3Tg standard conditions Fig. 1 with image from Villasenor et al., 2019
pancreatic B cell increased amount, abnormal hhexs721/s721; gz19Tg standard conditions Fig. S1 from Villasenor et al., 2019
pancreatic A cell increased amount, abnormal hhexs721/s721; gz19Tg standard conditions Fig. S1 from Villasenor et al., 2019
pancreatic D cell decreased amount, abnormal hhexs721/s721; gz19Tg standard conditions Fig. S1 from Villasenor et al., 2019
pancreas absent, abnormal hhexs721/s721; nim5Tg standard conditions Fig. 1 with image from Villasenor et al., 2019
liver decreased size, abnormal hhexs721/s721; nim5Tg standard conditions Fig. 1 with image from Villasenor et al., 2019
trunk vasculature morphology, abnormal hhexs721/s721; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
pericardium edematous, abnormal hhexs721/s721; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
facial lymphatic vessel decreased amount, abnormal hhexs721/s721; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
posterior cardinal vein sprouting angiogenesis disrupted, abnormal hhexs721/s721; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
intersegmental vessel absent, abnormal hhexs721/s721; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
trunk lymph vessel absent, abnormal hhexs721/s721; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
posterior cardinal vein sprouting angiogenesis disrupted, abnormal hhexs721/s721; nz101Tg; s843Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
thoracic duct intersegmental vessel absent, abnormal hhexs721/s721; nz101Tg; s843Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
somite intersegmental vein decreased amount, abnormal hhexs721/s721; nz101Tg; s843Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
digestive system duct hepaticobiliary system development decreased occurrence, abnormal hhexs721/s721; s870Tg standard conditions Fig. 2 from Villasenor et al., 2019
digestive system duct absent, abnormal hhexs721/s721; s870Tg standard conditions Fig. 2 from Villasenor et al., 2019
intestinal bulb decreased thickness, abnormal hhexs721/s721; s870Tg standard conditions Fig. 2 from Villasenor et al., 2019
primordial hindbrain channel immature, abnormal hhexs721/s721; y7Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
posterior cardinal vein endothelial cell decreased amount, abnormal hhexs722/s722; nim5Tg standard conditions Fig. 3 with image from Gauvrit et al., 2018
endothelial cell TagRFP expression decreased amount, abnormal hhexs722/s722; nim5Tg; s843Tg standard conditions Fig. 3 with image from Gauvrit et al., 2018
pericardium edematous, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
trunk vasculature morphology, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
facial lymphatic vessel decreased amount, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 1 with image,  Fig. S2 with image from Gauvrit et al., 2018
posterior cardinal vein sprouting angiogenesis disrupted, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
otolithic lymph vessel decreased amount, abnormal hhexs722/s722; nz101Tg standard conditions Fig. S2 with image from Gauvrit et al., 2018
thoracic duct intersegmental vessel absent, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 2 with image from Gauvrit et al., 2018
intersegmental vessel absent, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 1 with image from Gauvrit et al., 2018
trunk lymph vessel absent, abnormal hhexs722/s722; nz101Tg standard conditions Fig. 1 with image,  Fig. 2 with image from Gauvrit et al., 2018
posterior cardinal vein sprouting angiogenesis disrupted, abnormal hhexs722/s722; nz101Tg; s843Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
thoracic duct intersegmental vessel absent, abnormal hhexs722/s722; nz101Tg; s843Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
somite intersegmental vein decreased amount, abnormal hhexs722/s722; nz101Tg; s843Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
intersegmental vessel absent, abnormal hhexs722/s722; s843Tg standard conditions Fig. 2 with image from Gauvrit et al., 2018
trunk vasculature morphology, abnormal hhexs722/s722; s843Tg standard conditions Fig. 2 with image from Gauvrit et al., 2018
primordial hindbrain channel immature, abnormal hhexs722/s722; y7Tg standard conditions Fig. S1 with image from Gauvrit et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.