TALEN

TALEN1-cbfb

ID
ZDB-TALEN-170921-3
Name
TALEN1-cbfb
Previous Names
None
Target
Target Sequence 1
5' - TTAAATACACCGGTTTCCGC - 3'
Target Sequence 2
5' - TTCTGGAAGCGCGCCTGCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
w128 cbfb
Expression
Gene expression in Wild Types + TALEN1-cbfb
No data available
Phenotype
Phenotype resulting from TALEN1-cbfb
No data available
Phenotype of all Fish created by or utilizing TALEN1-cbfb
Phenotype Fish Conditions Figures
Rohon-Beard neuron piezo2b expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 8 with image from Gau et al., 2017
trigeminal ganglion ntrk3a expression decreased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 5 with image,  Fig. 10 with image,  Fig. 11 with image from Gau et al., 2017
Rohon-Beard neuron trpa1b expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 8 with image from Gau et al., 2017
trigeminal ganglion runx3 expression decreased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 4 with image from Gau et al., 2017
trigeminal ganglion ntrk3a expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 5 with image from Gau et al., 2017
response to chemical behavioral quality of a process, abnormal cbfbw128/w128 (AB) control Fig. 9 from Gau et al., 2017
Rohon-Beard neuron runx3 expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 3 with image from Gau et al., 2017
trigeminal ganglion piezo2b expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 7 with image from Gau et al., 2017
Rohon-Beard neuron runx3 expression decreased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 3 with image from Gau et al., 2017
Rohon-Beard neuron runx1 expression decreased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 3 with image from Gau et al., 2017
trigeminal ganglion trpa1b expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 7 with image from Gau et al., 2017
trigeminal ganglion cbfb expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 4 with image from Gau et al., 2017
Rohon-Beard neuron cbfb expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 3 with image from Gau et al., 2017
trigeminal ganglion ntrk2a expression increased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 5 with image,  Fig. 10 with image,  Fig. 11 with image from Gau et al., 2017
Rohon-Beard neuron ntrk2a expression increased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 6 with image from Gau et al., 2017
Rohon-Beard neuron ntrk3a expression absent, abnormal cbfbw128/w128 (AB) standard conditions Fig. 6 with image from Gau et al., 2017
Rohon-Beard neuron ntrk3a expression decreased amount, abnormal cbfbw128/w128 (AB) standard conditions Fig. 6 with image from Gau et al., 2017
trigeminal ganglion EGFP expression absent, abnormal cbfbw128/w128; a129Tg (AB) standard conditions Fig. 7 with image,  Fig. 10 with image from Gau et al., 2017
Rohon-Beard neuron EGFP expression absent, abnormal cbfbw128/w128; a129Tg (AB) standard conditions Fig. 8 with image from Gau et al., 2017
Citations