TALEN

TALEN2-cyp19a1a

ID
ZDB-TALEN-170113-1
Name
TALEN2-cyp19a1a
Previous Names
None
Target
Target Sequence 1
5' - TGTCTCCTACTGTCGGTTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - TTGTAGTAGTTGCTGGCAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo5 cyp19a1a
Expression
Gene expression in Wild Types + TALEN2-cyp19a1a
No data available
Phenotype
Phenotype resulting from TALEN2-cyp19a1a
No data available
Phenotype of all Fish created by or utilizing TALEN2-cyp19a1a
Phenotype Fish Conditions Figures
urogenital papilla external to whole organism, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 5 from Song et al., 2019
male organism decreased male fertility, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 4 from Song et al., 2019
sperm absent, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 4 from Song et al., 2019
female sex determination occurrence, ameliorated cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 2,  Fig. 3,  Fig. 6 from Song et al., 2019
whole organism color, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 5 from Song et al., 2019
female sex determination increased process quality, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 1 from Song et al., 2019
ovarian follicle atretic, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 5 from Song et al., 2019
sperm decreased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4,  Fig. 5 from Song et al., 2019
spermatogenic cyst increased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
ovarian follicle stage I increased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 3 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5 standard conditions Fig. 1,  Fig. 2,  Fig. 3,  Fig. 6 from Song et al., 2019
ovarian follicle stage III decreased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 3 from Song et al., 2019
spermatogenesis delayed, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
testis decreased size, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
ovarian follicle stage II decreased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 3 from Song et al., 2019
whole organism color, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 5 from Song et al., 2019
developmental process involved in reproduction delayed, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 2 from Song et al., 2019
female organism decreased female fertility, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 4 from Song et al., 2019
whole organism shape, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 5 from Song et al., 2019
sperm decreased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 4,  Fig. 5 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5 standard conditions Fig. 6 from Song et al., 2019
whole organism shape, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 5 from Song et al., 2019
sperm absent, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
female sex determination occurrence, ameliorated cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 2,  Fig. 3 from Song et al., 2019
ovarian follicle morphology, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 5 from Song et al., 2019
urogenital papilla external to whole organism, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 5 from Song et al., 2019
female organism decreased female fertility, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
developmental process involved in reproduction delayed, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 2 from Song et al., 2019
ovarian follicle stage III decreased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 3 from Song et al., 2019
male organism decreased male fertility, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
ovarian follicle stage II normal amount, ameliorated cyp19a1aumo5/umo5 chemical treatment by environment: 17beta-estradiol Fig. 3 from Song et al., 2019
ovarian follicle stage I increased amount, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 3 from Song et al., 2019
female sex determination increased process quality, abnormal cyp19a1aumo5/umo5 chemical treatment by environment: bisphenol A Fig. 1 from Song et al., 2019
ovary absent, abnormal cyp19a1aumo5/umo5 (AB) standard conditions Fig. 2 with image from Lau et al., 2016
female organism present, ameliorated cyp19a1aumo5/umo5 (AB) chemical treatment by environment: 17alpha-ethynylestradiol Fig. 8 with image from Lau et al., 2016
female gonad development process quality, ameliorated cyp19a1aumo5/umo5 (AB) chemical treatment by environment: 17alpha-ethynylestradiol Fig. 8 with image from Lau et al., 2016
female sex determination arrested, abnormal cyp19a1aumo5/umo5 (AB) standard conditions Fig. 2 with image from Lau et al., 2016
female organism absent, abnormal cyp19a1aumo5/umo5 (AB) standard conditions Fig. 2 with image from Lau et al., 2016
female sex determination increased process quality, abnormal cyp19a1aumo5/+ chemical treatment by environment: 17beta-estradiol Fig. 1 from Song et al., 2019
spermatogenic cyst increased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
ovarian follicle stage I increased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: 17beta-estradiol Fig. 2,  Fig. 3 from Song et al., 2019
spermatogenesis delayed, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
ovarian follicle stage III decreased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 2,  Fig. 3 from Song et al., 2019
testis decreased size, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
ovarian follicle stage II decreased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 2,  Fig. 3 from Song et al., 2019
developmental process involved in reproduction delayed, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 2 from Song et al., 2019
sperm absent, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 4 from Song et al., 2019
developmental process involved in reproduction delayed, abnormal cyp19a1aumo5/+ chemical treatment by environment: 17beta-estradiol Fig. 2 from Song et al., 2019
ovarian follicle stage III decreased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: 17beta-estradiol Fig. 2,  Fig. 3 from Song et al., 2019
ovarian follicle stage II decreased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: 17beta-estradiol Fig. 2 from Song et al., 2019
ovarian follicle stage II normal amount, ameliorated cyp19a1aumo5/+ chemical treatment by environment: 17beta-estradiol Fig. 3 from Song et al., 2019
ovarian follicle stage I increased amount, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 2,  Fig. 3 from Song et al., 2019
female sex determination increased process quality, abnormal cyp19a1aumo5/+ chemical treatment by environment: bisphenol A Fig. 1 from Song et al., 2019
female organism decreased amount, abnormal cyp19a1aumo5/+ (AB) standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/+ (AB) standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/+ (AB) standard conditions Fig. 4 with image from Wu et al., 2020
male organism estradiol decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+ (AB) standard conditions Fig. 1 from Wu et al., 2020
blood estradiol decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+ (AB) standard conditions Fig. 1 from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15 (AB) standard conditions Fig. 1 from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15 (AB) standard conditions Fig. 1 from Wu et al., 2020
male organism estradiol decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+ (AB) standard conditions Fig. 1 from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+ (AB) standard conditions Fig. 1 from Wu et al., 2020
blood estradiol decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+ (AB) standard conditions Fig. 1 from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+ (AB) standard conditions Fig. 1 from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 1 from Wu et al., 2020
ovarian follicle stage III decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 2 with image from Wu et al., 2020
male organism estradiol decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 1 from Wu et al., 2020
ovarian follicle stage IV decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 2 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 1 from Wu et al., 2020
blood estradiol decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 1 from Wu et al., 2020
ovarian follicle stage II increased size, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15 (AB) standard conditions Fig. 2 with image from Wu et al., 2020
ovary absent, abnormal cyp19a1aumo5/umo5; zf45Tg/+ (AB) standard conditions Fig. 8 with image from Lau et al., 2016
female gonad development arrested, abnormal cyp19a1aumo5/umo5; zf45Tg/+ (AB) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Lau et al., 2016
female organism absent, abnormal cyp19a1aumo5/umo5; zf45Tg/+ (AB) standard conditions Fig. 8 with image from Lau et al., 2016
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination decreased occurrence, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination occurrence, ameliorated cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/+; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development normal occurrence, ameliorated cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/+; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
male organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
ovarian follicle degenerate, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
ovarian follicle degenerate, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.