TALEN

TALEN1-pax7b

ID
ZDB-TALEN-160728-2
Name
TALEN1-pax7b
Previous Names
None
Target
Target Sequence 1
5' - AGAATGTCATCCTTACCGGGAAC - 3'
Target Sequence 2
5' - AGTTCTGTCCTGGAGCCGGTCGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umu4 pax7b
Expression
Gene expression in Wild Types + TALEN1-pax7b
No data available
Phenotype
Phenotype resulting from TALEN1-pax7b
No data available
Phenotype of all Fish created by or utilizing TALEN1-pax7b
Phenotype Fish Conditions Figures
pectoral fin pax7b expression decreased amount, abnormal pax7bumu4/umu4 standard conditions Fig. 6 with image from Nord et al., 2021
pectoral fin pax7a expression decreased amount, abnormal pax7bumu4/umu4 standard conditions Fig. 6 with image from Nord et al., 2021
integument pigmentation decreased process quality, abnormal pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
trunk has fewer parts of type melanocyte, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 6 with imageFig. 7 with image from Nord et al., 2016
whole organism has fewer parts of type xanthoblast, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 4 with image from Nord et al., 2016
head has extra parts of type melanoblast, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2016
whole organism pax3b expression increased amount, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 7 with image from Nord et al., 2021
pectoral fin pax7a expression decreased amount, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 6 with image from Nord et al., 2021
head larval melanophore stripe has extra parts of type melanocyte, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2016
xanthophore differentiation decreased process quality, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 4 with image from Nord et al., 2016
integument pigmentation decreased process quality, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
trunk ab-pax7 labeling absent, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2016
dorsal larval melanophore stripe has extra parts of type melanocyte, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2016
trunk melanocyte disorganized, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 7 with image from Nord et al., 2016
whole organism lacks all parts of type xanthophore, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 4 with image from Nord et al., 2016
whole organism pax3a expression increased amount, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 7 with image from Nord et al., 2021
pectoral fin pax7b expression decreased amount, abnormal pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 6 with image from Nord et al., 2021
myotome EGFP expression increased amount, abnormal pax7aumu3/umu3; pax7bumu4/umu4; i150Tg perforation: somite 10 Fig. 8 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
trunk curved ventral, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
primitive pectoral fin adductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
whole organism lethal (sensu genetics), abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
integument pigmentation decreased process quality, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
trunk curved ventral, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
whole organism lethal (sensu genetics), abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
myotome EGFP expression increased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4; i150Tg perforation: somite 10 Fig. 8 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
primitive pectoral fin abductor lacks all parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
primitive pectoral fin adductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
whole organism lethal (sensu genetics), abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
trunk curved ventral, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature paralysed, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
posterior hypaxial muscle myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
Citations