Morpholino

MO1-wbp11

ID
ZDB-MRPHLNO-261005-3
Name
MO1-wbp11
Previous Names
None
Target
Sequence
5' - CCGGCAGCGGTCACCTCTATTAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wbp11
No data available
Phenotype
Phenotype resulting from MO1-wbp11
Phenotype Fish Figures
atrium misaligned with cardiac ventricle, abnormal f1Tg + MO1-wbp11 (AB) Figure 5 with image from Chen et al., 2026
cardiac ventricle myh7 expression increased distribution, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
caudal vein plexus kdrl expression decreased distribution, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
caudal vein plexus decreased width, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
cranial blood vessel area density, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
cranial blood vessel kdrl expression decreased distribution, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
heart linear, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
heart myl7 expression spatial pattern, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
heart looping decreased process quality, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
notochord curved, abnormal AB + MO1-wbp11 Figure 7 with image from Chen et al., 2026
notochord shha expression spatial pattern, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
pectoral fin bud tbx5a expression decreased distribution, abnormal AB + MO1-wbp11 Fig. 8 with image from Chen et al., 2026
pericardium edematous, abnormal AB + MO1-wbp11 Figure 3 with image,  Figure 5 with image from Chen et al., 2026
post-vent region curved, abnormal AB + MO1-wbp11 Figure 3 with image,  Figure 7 with image from Chen et al., 2026
subintestinal vein decreased branchiness, abnormal y1Tg + MO1-wbp11 (AB) Figure 6 with image from Chen et al., 2026
subintestinal vein EGFP expression decreased distribution, abnormal y1Tg + MO1-wbp11 (AB) Figure 6 with image from Chen et al., 2026
subintestinal vein hypoplastic, abnormal y1Tg + MO1-wbp11 (AB) Figure 6 with image from Chen et al., 2026
subintestinal vein EGFP expression spatial pattern, abnormal y1Tg + MO1-wbp11 (AB) Figure 6 with image from Chen et al., 2026
trunk curvature, abnormal AB + MO1-wbp11 Figure 7 with image from Chen et al., 2026
whole organism Ab1-wbp11 labeling absent, abnormal AB + MO1-wbp11 Figure 3 with image from Chen et al., 2026
whole organism hoxc13a expression decreased amount, abnormal AB + MO1-wbp11 Fig. 8 with image from Chen et al., 2026
whole organism Ab1-wbp11 labeling decreased amount, abnormal AB + MO1-wbp11 Figure 3 with image from Chen et al., 2026
whole organism tpm1 expression decreased amount, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
whole organism hoxb13a expression decreased amount, abnormal AB + MO1-wbp11 Fig. 8 with image from Chen et al., 2026
whole organism sox9a expression decreased amount, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
whole organism myh7 expression decreased amount, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
whole organism aggf1 expression increased amount, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
whole organism notch3 expression increased amount, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
whole organism actc1a expression increased amount, abnormal AB + MO1-wbp11 Figure 5 with image from Chen et al., 2026
whole organism fgf23 expression increased amount, abnormal AB + MO1-wbp11 Figure 6 with image from Chen et al., 2026
whole organism prdm1a expression increased amount, abnormal AB + MO1-wbp11 Fig. 8 with image from Chen et al., 2026
whole organism developmental process delayed phase, abnormal AB + MO1-wbp11 Figure 3 with image from Chen et al., 2026
Phenotype of all Fish created by or utilizing MO1-wbp11
Phenotype Fish Conditions Figures
whole organism Ab1-wbp11 labeling absent, abnormal AB + MO1-wbp11 control Figure 3 with image from Chen et al., 2026
pericardium edematous, abnormal AB + MO1-wbp11 control Figure 3 with image,  Figure 5 with image from Chen et al., 2026
caudal vein plexus kdrl expression decreased distribution, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
post-vent region curved, abnormal AB + MO1-wbp11 control Figure 3 with image,  Figure 7 with image from Chen et al., 2026
whole organism hoxb13a expression decreased amount, abnormal AB + MO1-wbp11 control Fig. 8 with image from Chen et al., 2026
whole organism notch3 expression increased amount, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
heart looping decreased process quality, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
notochord curved, abnormal AB + MO1-wbp11 control Figure 7 with image from Chen et al., 2026
whole organism actc1a expression increased amount, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
whole organism hoxc13a expression decreased amount, abnormal AB + MO1-wbp11 control Fig. 8 with image from Chen et al., 2026
whole organism aggf1 expression increased amount, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
pectoral fin bud tbx5a expression decreased distribution, abnormal AB + MO1-wbp11 control Fig. 8 with image from Chen et al., 2026
trunk curvature, abnormal AB + MO1-wbp11 control Figure 7 with image from Chen et al., 2026
heart myl7 expression spatial pattern, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
cardiac ventricle myh7 expression increased distribution, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
whole organism myh7 expression decreased amount, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
whole organism developmental process delayed phase, abnormal AB + MO1-wbp11 control Figure 3 with image from Chen et al., 2026
whole organism Ab1-wbp11 labeling decreased amount, abnormal AB + MO1-wbp11 control Figure 3 with image from Chen et al., 2026
notochord shha expression spatial pattern, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
whole organism sox9a expression decreased amount, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
cranial blood vessel area density, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
heart linear, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
cranial blood vessel kdrl expression decreased distribution, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
caudal vein plexus decreased width, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
whole organism fgf23 expression increased amount, abnormal AB + MO1-wbp11 control Figure 6 with image from Chen et al., 2026
whole organism tpm1 expression decreased amount, abnormal AB + MO1-wbp11 control Figure 5 with image from Chen et al., 2026
whole organism prdm1a expression increased amount, abnormal AB + MO1-wbp11 control Fig. 8 with image from Chen et al., 2026
atrium misaligned with cardiac ventricle, abnormal f1Tg + MO1-wbp11 (AB) control Figure 5 with image from Chen et al., 2026
subintestinal vein EGFP expression spatial pattern, abnormal y1Tg + MO1-wbp11 (AB) control Figure 6 with image from Chen et al., 2026
subintestinal vein EGFP expression decreased distribution, abnormal y1Tg + MO1-wbp11 (AB) control Figure 6 with image from Chen et al., 2026
subintestinal vein decreased branchiness, abnormal y1Tg + MO1-wbp11 (AB) control Figure 6 with image from Chen et al., 2026
subintestinal vein hypoplastic, abnormal y1Tg + MO1-wbp11 (AB) control Figure 6 with image from Chen et al., 2026
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.