Morpholino

MO1-ndufb7

ID
ZDB-MRPHLNO-250513-4
Name
MO1-ndufb7
Previous Names
None
Target
Sequence
5' - CAAGATGAGCGCCCATCCCGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ndufb7
No data available
Phenotype
Phenotype resulting from MO1-ndufb7
Phenotype Fish Figures
fourth ventricle increased size, abnormal AB + MO1-ndufb7 Fig. 3 with image,  Fig. 4 with image from Chen et al., 2025
hindbrain neuron decreased volume, abnormal rw0130aTg + MO1-ndufb7 Fig. 5 with image from Chen et al., 2025
midbrain neuron decreased volume, abnormal rw0130aTg + MO1-ndufb7 Fig. 5 with image from Chen et al., 2025
oxygen metabolic process decreased process quality, abnormal rw0130aTg + MO1-ndufb7 Fig. 7 with image from Chen et al., 2025
tectal ventricle decreased size, abnormal AB + MO1-ndufb7 Fig. 3 with image,  Fig. 4 with image from Chen et al., 2025
whole organism (S)-lactic acid increased amount, abnormal AB + MO1-ndufb7 Fig. 6 with image from Chen et al., 2025
whole organism mitochondrion decreased functionality, abnormal rw0130aTg + MO1-ndufb7 Fig. 7 with image from Chen et al., 2025
Phenotype of all Fish created by or utilizing MO1-ndufb7
Phenotype Fish Conditions Figures
tectal ventricle size, ameliorated AB + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 3 with image,  Fig. 4 with image from Chen et al., 2025
whole organism (S)-lactic acid increased amount, abnormal AB + MO1-ndufb7 control Fig. 6 with image from Chen et al., 2025
fourth ventricle size, ameliorated AB + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 3 with image,  Fig. 4 with image from Chen et al., 2025
tectal ventricle decreased size, abnormal AB + MO1-ndufb7 control Fig. 3 with image,  Fig. 4 with image from Chen et al., 2025
fourth ventricle increased size, abnormal AB + MO1-ndufb7 control Fig. 3 with image,  Fig. 4 with image from Chen et al., 2025
whole organism (S)-lactic acid amount, ameliorated AB + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 6 with image from Chen et al., 2025
midbrain neuron decreased volume, abnormal rw0130aTg + MO1-ndufb7 control Fig. 5 with image from Chen et al., 2025
oxygen metabolic process decreased process quality, abnormal rw0130aTg + MO1-ndufb7 control Fig. 7 with image from Chen et al., 2025
whole organism mitochondrion functionality, ameliorated rw0130aTg + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 7 with image from Chen et al., 2025
hindbrain neuron volume, ameliorated rw0130aTg + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 5 with image from Chen et al., 2025
midbrain neuron volume, ameliorated rw0130aTg + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 5 with image from Chen et al., 2025
hindbrain neuron decreased volume, abnormal rw0130aTg + MO1-ndufb7 control Fig. 5 with image from Chen et al., 2025
oxygen metabolic process process quality, ameliorated rw0130aTg + MO1-ndufb7 chemical treatment by injection: Mitoquinone Fig. 7 with image from Chen et al., 2025
whole organism mitochondrion decreased functionality, abnormal rw0130aTg + MO1-ndufb7 control Fig. 7 with image from Chen et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.