Morpholino

MO3-onecut1

ID
ZDB-MRPHLNO-250505-1
Name
MO3-onecut1
Previous Names
None
Target
Sequence
5' - GCTTGTGGACAAATCATCTATCTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-onecut1
No data available
Phenotype
Phenotype resulting from MO3-onecut1
Phenotype Fish Figures
amacrine cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 5 with image from Vassalli et al., 2024
eye decreased size, abnormal AB + MO3-onecut1 Figure 3 with image from Vassalli et al., 2024
eye morphology, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 5 with image from Vassalli et al., 2024
horizontal cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 5 with image from Vassalli et al., 2024
retinal ganglion cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 5 with image from Vassalli et al., 2024
retinal outer nuclear layer decreased size, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 5 with image from Vassalli et al., 2024
swimming behavior increased linear velocity, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 6 with image from Vassalli et al., 2024
swimming behavior increased process quality, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 Figure 6 with image from Vassalli et al., 2024
Phenotype of all Fish created by or utilizing MO3-onecut1
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB + MO3-onecut1 standard conditions Figure 3 with image from Vassalli et al., 2024
amacrine cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
horizontal cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
eye morphology, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
retinal ganglion cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
retinal outer nuclear layer decreased size, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
swimming behavior increased process quality, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 6 with image from Vassalli et al., 2024
swimming behavior increased linear velocity, abnormal cu2Tg; jh1Tg; q20Tg + MO3-onecut1 standard conditions Figure 6 with image from Vassalli et al., 2024
whole organism tmtc2a expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
eye decreased size, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 3 with image from Vassalli et al., 2024
whole organism cplx2b expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
whole organism diras1a expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
whole organism cplx2a expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
retinal outer nuclear layer decreased size, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
amacrine cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
eye morphology, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
retinal ganglion cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
horizontal cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
swimming behavior increased process quality, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 6 with image from Vassalli et al., 2024
photoreceptor cell axon terminus absence of anatomical entity, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
swimming behavior increased linear velocity, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 6 with image from Vassalli et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.