Morpholino

MO1-fxn

ID
ZDB-MRPHLNO-250501-1
Name
MO1-fxn
Previous Names
None
Target
Sequence
5' - CTAAATTTACCTGAGGTGATGTGCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fxn
No data available
Phenotype
Phenotype resulting from MO1-fxn
Phenotype Fish Figures
brain cell death increased process quality, abnormal WT + MO1-fxn FIGURE 7 with image from Ercanbrack et al., 2024
ceratobranchial cartilage absence of anatomical entity, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
head opaque, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
head cell death increased process quality, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
Meckel's cartilage split, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
otolith increased amount, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
pericardium accumulation blood, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
pericardium edematous, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
podocyte wt1b expression decreased distribution, abnormal WT + MO1-fxn FIGURE 4 with image from Ercanbrack et al., 2024
podocyte nphs1 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 3 with image from Ercanbrack et al., 2024
post-vent region decreased length, abnormal WT + MO1-fxn FIGURE 8 with image from Ercanbrack et al., 2024
pronephric distal early tubule kcnj1a.1 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 4 with image from Ercanbrack et al., 2024
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 3 with image from Ercanbrack et al., 2024
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 3 with image from Ercanbrack et al., 2024
pronephric distal late tubule gata3 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 4 with image from Ercanbrack et al., 2024
pronephric proximal convoluted tubule endocytosis decreased process quality, abnormal WT + MO1-fxn FIGURE 6 with image from Ercanbrack et al., 2024
pronephric tubule cdh17 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 8 with image from Ercanbrack et al., 2024
pronephric tubule decreased length, abnormal WT + MO1-fxn FIGURE 8 with image from Ercanbrack et al., 2024
pronephros cell death increased process quality, abnormal WT + MO1-fxn FIGURE 7 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell cetn4 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 5 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell trim35-30 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 4 with image,  FIGURE 5 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell pax2a expression decreased distribution, abnormal WT + MO1-fxn FIGURE 5 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell jag2b expression decreased distribution, abnormal WT + MO1-fxn FIGURE 5 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell cetn2 expression decreased distribution, abnormal WT + MO1-fxn FIGURE 3 with image from Ercanbrack et al., 2024
renal filtration decreased process quality, abnormal WT + MO1-fxn FIGURE 6 with image from Ercanbrack et al., 2024
ventral mandibular arch decreased size, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
ventral mandibular arch morphology, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
whole organism viability, abnormal WT + MO1-fxn FIGURE 2 with image from Ercanbrack et al., 2024
Phenotype of all Fish created by or utilizing MO1-fxn
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
whole organism viability, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
ceratobranchial cartilage absence of anatomical entity, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
Meckel's cartilage split, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
head cell death increased process quality, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
pronephric distal late tubule gata3 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 4 with image from Ercanbrack et al., 2024
podocyte nphs1 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 3 with image from Ercanbrack et al., 2024
pronephric proximal convoluted tubule endocytosis decreased process quality, abnormal WT + MO1-fxn control FIGURE 6 with image from Ercanbrack et al., 2024
ventral mandibular arch morphology, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
pronephric tubule cdh17 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 8 with image from Ercanbrack et al., 2024
pericardium accumulation blood, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
renal filtration decreased process quality, abnormal WT + MO1-fxn control FIGURE 6 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell cetn2 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 3 with image from Ercanbrack et al., 2024
pronephros cell death increased process quality, abnormal WT + MO1-fxn control FIGURE 7 with image from Ercanbrack et al., 2024
brain cell death increased process quality, abnormal WT + MO1-fxn control FIGURE 7 with image from Ercanbrack et al., 2024
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 3 with image from Ercanbrack et al., 2024
head opaque, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
pronephric tubule decreased length, abnormal WT + MO1-fxn control FIGURE 8 with image from Ercanbrack et al., 2024
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 3 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell trim35-30 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 4 with image,  FIGURE 5 with image from Ercanbrack et al., 2024
ventral mandibular arch decreased size, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
pronephric distal early tubule kcnj1a.1 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 4 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell cetn4 expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 5 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell pax2a expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 5 with image from Ercanbrack et al., 2024
otolith increased amount, abnormal WT + MO1-fxn control FIGURE 2 with image from Ercanbrack et al., 2024
podocyte wt1b expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 4 with image from Ercanbrack et al., 2024
pronephros multi-ciliated epithelial cell jag2b expression decreased distribution, abnormal WT + MO1-fxn control FIGURE 5 with image from Ercanbrack et al., 2024
post-vent region decreased length, abnormal WT + MO1-fxn control FIGURE 8 with image from Ercanbrack et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.