Morpholino

MO2-nkx2.3

ID
ZDB-MRPHLNO-240918-2
Name
MO2-nkx2.3
Previous Names
None
Target
Sequence
5' - CGCTGTTGGATTACATCTACAATGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nkx2.3
No data available
Phenotype
Phenotype resulting from MO2-nkx2.3
Phenotype Fish Figures
ceratobranchial cartilage absence of anatomical entity, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 1 with imageFig. 5 with imageFig. 7 with image from Yang et al., 2023
ceratohyal cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
epibranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
head decreased size, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
hypobranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
mandibular arch skeleton decreased size, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
Meckel's cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
palatoquadrate cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch fgf3 expression increased distribution, abnormal TU + MO2-nkx2.3 Fig. 6 with image from Yang et al., 2023
pharyngeal arch fgf8a expression increased distribution, abnormal TU + MO2-nkx2.3 Fig. 6 with image from Yang et al., 2023
pharyngeal arch cartilage gsc expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage col2a1a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage sox9a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage Ab36-h3 labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage cell population proliferation decreased process quality, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage chondrocyte ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage posterior region ab1-gfp labeling spatial pattern, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
Phenotype of all Fish created by or utilizing MO2-nkx2.3
Phenotype Fish Conditions Figures
pharyngeal arch fgf3 expression increased distribution, abnormal TU + MO2-nkx2.3 control Fig. 6 with image from Yang et al., 2023
mandibular arch skeleton decreased size, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
hypobranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
epibranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
ceratobranchial cartilage morphology, ameliorated TU + MO2-nkx2.3 chemical treatment by environment: SU5402 Fig. 7 with image from Yang et al., 2023
pharyngeal arch fgf8a expression increased distribution, abnormal TU + MO2-nkx2.3 control Fig. 6 with image from Yang et al., 2023
head decreased size, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
ceratobranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 control Fig. 1 with imageFig. 7 with image from Yang et al., 2023
ceratobranchial cartilage absence of anatomical entity, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
palatoquadrate cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage sox9a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage chondrocyte ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage gsc expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage Ab36-h3 labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
Meckel's cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage posterior region ab1-gfp labeling spatial pattern, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage col2a1a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage cell population proliferation decreased process quality, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
ceratohyal cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
mandibular arch skeleton decreased size, abnormal tp53zdf1/zdf1 + MO2-nkx2.3 (TU) control Fig. 1 with image from Yang et al., 2023
head decreased size, abnormal tp53zdf1/zdf1 + MO2-nkx2.3 (TU) control Fig. 1 with image from Yang et al., 2023
Citations