Morpholino

MO2-nkx2.3

ID
ZDB-MRPHLNO-240918-2
Name
MO2-nkx2.3
Previous Names
None
Target
Sequence
5' - CGCTGTTGGATTACATCTACAATGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nkx2.3
Expressed Gene Anatomy Figures
col2a1a Fig. 5 with image from Yang et al., 2023
fgf3 Fig. 6 with image from Yang et al., 2023
fgf8a Fig. 6 with image from Yang et al., 2023
gsc Fig. 5 with image from Yang et al., 2023
sox9a Fig. 5 with image from Yang et al., 2023
Phenotype
Phenotype resulting from MO2-nkx2.3
Phenotype Fish Figures
ceratobranchial cartilage absence of anatomical entity, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 1 with image,  Fig. 5 with image,  Fig. 7 with image from Yang et al., 2023
ceratohyal cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
epibranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
head decreased size, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
hypobranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
mandibular arch skeleton decreased size, abnormal TU + MO2-nkx2.3 Fig. 1 with image from Yang et al., 2023
Meckel's cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
palatoquadrate cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch fgf3 expression increased distribution, abnormal TU + MO2-nkx2.3 Fig. 6 with image from Yang et al., 2023
pharyngeal arch fgf8a expression increased distribution, abnormal TU + MO2-nkx2.3 Fig. 6 with image from Yang et al., 2023
pharyngeal arch cartilage gsc expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage col2a1a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage sox9a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage Ab36-h3 labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage cell population proliferation decreased process quality, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage chondrocyte ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage posterior region ab1-gfp labeling spatial pattern, abnormal y1Tg + MO2-nkx2.3 (TU) Fig. 4 with image from Yang et al., 2023
Phenotype of all Fish created by or utilizing MO2-nkx2.3
Phenotype Fish Conditions Figures
pharyngeal arch fgf3 expression increased distribution, abnormal TU + MO2-nkx2.3 control Fig. 6 with image from Yang et al., 2023
mandibular arch skeleton decreased size, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
hypobranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
epibranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
ceratobranchial cartilage morphology, ameliorated TU + MO2-nkx2.3 chemical treatment by environment: SU5402 Fig. 7 with image from Yang et al., 2023
pharyngeal arch fgf8a expression increased distribution, abnormal TU + MO2-nkx2.3 control Fig. 6 with image from Yang et al., 2023
head decreased size, abnormal TU + MO2-nkx2.3 control Fig. 1 with image from Yang et al., 2023
ceratobranchial cartilage absence of anatomical entity, abnormal TU + MO2-nkx2.3 control Fig. 1 with image,  Fig. 7 with image from Yang et al., 2023
ceratobranchial cartilage absence of anatomical entity, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
palatoquadrate cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage sox9a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage chondrocyte ab1-gfp labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage gsc expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage Ab36-h3 labeling decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
Meckel's cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage posterior region ab1-gfp labeling spatial pattern, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
pharyngeal arch cartilage col2a1a expression decreased distribution, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
pharyngeal arch cartilage cell population proliferation decreased process quality, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 4 with image from Yang et al., 2023
ceratohyal cartilage morphology, abnormal y1Tg + MO2-nkx2.3 (TU) control Fig. 5 with image from Yang et al., 2023
mandibular arch skeleton decreased size, abnormal tp53zdf1/zdf1 + MO2-nkx2.3 (TU) control Fig. 1 with image from Yang et al., 2023
head decreased size, abnormal tp53zdf1/zdf1 + MO2-nkx2.3 (TU) control Fig. 1 with image from Yang et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.