Morpholino

MO1-loxhd1b

ID

ZDB-MRPHLNO-240219-13

Name

MO1-loxhd1b

Previous Names

None

Target

Sequence

5' - CAGTGATGCTGAAAGTCTGACTTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-loxhd1b

No data available

Phenotype

Phenotype resulting from MO1-loxhd1b

Phenotype	Fish	Figures
anterior crista auditory receptor cell decreased amount, abnormal	AB + MO1-loxhd1b	FIGURE 2 , FIGURE 8 from Liu et al., 2022
lateral crista auditory receptor cell decreased amount, abnormal	AB + MO1-loxhd1b	FIGURE 2 , FIGURE 8 from Liu et al., 2022
otic vesicle decreased size, abnormal	AB + MO1-loxhd1b	FIGURE 5 , FIGURE 9 from Liu et al., 2022
otic vesicle morphology, abnormal	AB + MO1-loxhd1b	FIGURE 5 , FIGURE 9 from Liu et al., 2022
posterior crista auditory receptor cell decreased amount, abnormal	AB + MO1-loxhd1b	FIGURE 2 , FIGURE 8 from Liu et al., 2022
posterior lateral line neuromast neuromast hair cell Ab4-myo7a labeling decreased amount, abnormal	AB + MO1-loxhd1b	FIGURE 3 from Liu et al., 2022
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	AB + MO1-loxhd1b	FIGURE 2 , FIGURE 3 , FIGURE 8 from Liu et al., 2022
posterior lateral line neuromast neuromast support cell decreased amount, abnormal	AB + MO1-loxhd1b	FIGURE 3 , FIGURE 8 from Liu et al., 2022

Phenotype of all Fish created by or utilizing MO1-loxhd1b

Phenotype	Fish	Conditions	Figures
posterior crista auditory receptor cell decreased amount, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 2 , FIGURE 8 from Liu et al., 2022
otic vesicle morphology, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 5 , FIGURE 9 from Liu et al., 2022
posterior lateral line neuromast neuromast support cell decreased amount, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 3 , FIGURE 8 from Liu et al., 2022
anterior crista auditory receptor cell decreased amount, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 2 , FIGURE 8 from Liu et al., 2022
otic vesicle decreased size, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 5 , FIGURE 9 from Liu et al., 2022
posterior lateral line neuromast neuromast hair cell Ab4-myo7a labeling decreased amount, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 3 from Liu et al., 2022
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 2 , FIGURE 3 , FIGURE 8 from Liu et al., 2022
lateral crista auditory receptor cell decreased amount, abnormal	AB + MO1-loxhd1b	standard conditions	FIGURE 2 , FIGURE 8 from Liu et al., 2022

Citations