Morpholino

MO3-ift74

ID

ZDB-MRPHLNO-230324-1

Name

MO3-ift74

Previous Names

None

Target

ift74 (1)

Sequence

5' - CGACATCACTGACAGAAAGTCAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ift74

No data available

Phenotype

Phenotype resulting from MO3-ift74

Phenotype	Fish	Figures
eye photoreceptor cell opsin transport decreased rate of continuous process, abnormal	ouc2001Tg; ouc2006Tg + MO2-ift74 + MO3-ift74	Fig. S5 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased amount, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	Figure 6 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	Figure 6 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	Figure 6 from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	Figure 6 from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	Figure 6 from Zhu et al., 2021

Phenotype of all Fish created by or utilizing MO3-ift74

Phenotype	Fish	Conditions	Figures
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	control	Figure 6 from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	control	Figure 6 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	control	Figure 6 from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	control	Figure 6 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased amount, abnormal	ift74^{ouc2031/ouc2031} + MO3-ift74	control	Figure 6 from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal	WT + MO2-ift74 + MO3-ift74	control	Figure 6 from Zhu et al., 2021
post-vent region curved, abnormal	WT + MO2-ift74 + MO3-ift74	control	Figure 1 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal	WT + MO2-ift74 + MO3-ift74	control	Figure 6 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased amount, abnormal	WT + MO2-ift74 + MO3-ift74	control	Figure 6 from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal	WT + MO2-ift74 + MO3-ift74	control	Figure 6 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal	WT + MO2-ift74 + MO3-ift74	control	Figure 6 from Zhu et al., 2021
eye photoreceptor cell opsin transport decreased rate of continuous process, abnormal	ouc2001Tg; ouc2006Tg + MO2-ift74 + MO3-ift74	heat shock	Fig. S5 from Zhu et al., 2021

Citations