Morpholino

MO3-gars1

ID
ZDB-MRPHLNO-221117-1
Name
MO3-gars1
Previous Names
None
Target
Sequence
5' - GGGCCTGGAGGCAACATGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-gars1
No data available
Phenotype
Phenotype resulting from MO3-gars1
Phenotype Fish Figures
myotome neuromuscular junction of skeletal muscle fiber decreased amount, abnormal WT + MO3-gars1 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling decreased distribution, abnormal WT + MO3-gars1 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling spatial pattern, abnormal WT + MO3-gars1 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synapse decreased amount, abnormal WT + MO3-gars1 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling decreased distribution, abnormal WT + MO3-gars1 Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + MO3-gars1 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
whole organism Ab2-gars labeling decreased amount, abnormal WT + MO3-gars1 Fig. 1 with image from Jeong et al., 2022
whole organism swimming behavior decreased process quality, abnormal WT + MO3-gars1 Fig. 4 with image from Jeong et al., 2022
Phenotype of all Fish created by or utilizing MO3-gars1
Phenotype Fish Conditions Figures
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling decreased distribution, abnormal WT + MO3-gars1 control Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling spatial pattern, ameliorated WT + MO3-gars1 chemical treatment by environment: tubastatin A Fig. 5 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling spatial pattern, ameliorated WT + MO3-gars1 chemical treatment by environment: Pomiferin Fig. 6 with image from Jeong et al., 2022
whole organism swimming behavior decreased process quality, abnormal WT + MO3-gars1 control Fig. 4 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling spatial pattern, ameliorated WT + MO3-gars1 chemical treatment by environment: vorinostat Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber amount, ameliorated WT + MO3-gars1 chemical treatment by environment: vorinostat Fig. 6 with image from Jeong et al., 2022
myotome synapse decreased amount, abnormal WT + MO3-gars1 control Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + MO3-gars1 control Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synapse amount, ameliorated WT + MO3-gars1 chemical treatment by environment: tubastatin A Fig. 5 with image from Jeong et al., 2022
whole organism Ab2-gars labeling decreased amount, abnormal WT + MO3-gars1 control Fig. 1 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling decreased distribution, abnormal WT + MO3-gars1 control Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synapse amount, ameliorated WT + MO3-gars1 chemical treatment by environment: Pomiferin Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling spatial pattern, ameliorated WT + MO3-gars1 chemical treatment by environment: tubastatin A Fig. 5 with image from Jeong et al., 2022
myotome synaptic vesicle ab-sv2 labeling spatial pattern, ameliorated WT + MO3-gars1 chemical treatment by environment: vorinostat Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber amount, ameliorated WT + MO3-gars1 chemical treatment by environment: tubastatin A Fig. 5 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling spatial pattern, abnormal WT + MO3-gars1 control Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber ab-sv2 labeling spatial pattern, ameliorated WT + MO3-gars1 chemical treatment by environment: Pomiferin Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber amount, ameliorated WT + MO3-gars1 chemical treatment by environment: Pomiferin Fig. 6 with image from Jeong et al., 2022
myotome neuromuscular junction of skeletal muscle fiber decreased amount, abnormal WT + MO3-gars1 control Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Jeong et al., 2022
myotome synapse amount, ameliorated WT + MO3-gars1 chemical treatment by environment: vorinostat Fig. 6 with image from Jeong et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.