Morpholino

MO7-sox19b

ID
ZDB-MRPHLNO-200608-1
Name
MO7-sox19b
Previous Names
None
Target
Sequence
5' - GTCTTCAGCTCGTGCTCCATCATGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-sox19b
Expressed Gene Anatomy Figures
ascl1a Fig. 4 with image from Li et al., 2019
cdkn1a Fig. 4 with image from Li et al., 2019
cdkn1bb Fig. 4 with image from Li et al., 2019
cdkn1ca Fig. 4 with image from Li et al., 2019
elavl3 Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
etv1 Fig. 5 with image from Li et al., 2019
ezh2 Fig. 7 with image from Li et al., 2019
fgf3 Fig. 5 with image from Li et al., 2019
fgf8a Fig. 5 with image from Li et al., 2019
her3 Fig. 4 with image from Li et al., 2019
isl1a Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
neurog1 Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
otx2b Fig. 2 with image from Li et al., 2019
pax2a Fig. 2 with image from Li et al., 2019
Phenotype
Phenotype resulting from MO7-sox19b
Phenotype Fish Figures
axis decreased length, abnormal WT + MO7-sox19b Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
caudal fin curved dorsal, abnormal WT + MO7-sox19b Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
diencephalon decreased size, abnormal WT + MO7-sox19b Fig. 2 with image from Li et al., 2019
forebrain ventricle distended, abnormal WT + MO7-sox19b Fig. 3 with image from Li et al., 2019
head decreased size, abnormal WT + MO7-sox19b Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
head morphology, abnormal WT + MO7-sox19b Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
neural crest cell development decreased process quality, abnormal WT + MO7-sox19b Fig. 3 with image from Li et al., 2019
neural plate isl1a expression increased distribution, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
neural plate neurog1 expression increased distribution, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
neural plate elavl3 expression increased distribution, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
neural plate cell Ab36-h3 labeling absent, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
neuroectoderm pax2a expression decreased distribution, abnormal WT + MO7-sox19b Fig. 2 with image from Li et al., 2019
neuroectoderm anterior region otx2b expression decreased distribution, abnormal WT + MO7-sox19b Fig. 2 with image from Li et al., 2019
notochord morphology, abnormal WT + MO7-sox19b Fig. 3 with image from Li et al., 2019
telencephalon decreased size, abnormal WT + MO7-sox19b Fig. 2 with image from Li et al., 2019
thalamus decreased size, abnormal WT + MO7-sox19b Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
whole organism her3 expression decreased amount, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
whole organism etv1 expression decreased amount, abnormal WT + MO7-sox19b Fig. 5 with image from Li et al., 2019
whole organism ezh2 expression decreased amount, abnormal WT + MO7-sox19b Fig. 7 with image from Li et al., 2019
whole organism fgf3 expression decreased amount, abnormal WT + MO7-sox19b Fig. 5 with image from Li et al., 2019
whole organism ascl1a expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
whole organism cdkn1bb expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
whole organism neurog1 expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
whole organism cdkn1ca expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image from Li et al., 2019
whole organism elavl3 expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
whole organism isl1a expression increased amount, abnormal WT + MO7-sox19b Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
Phenotype of all Fish created by or utilizing MO7-sox19b
Phenotype Fish Conditions Figures
head morphology, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
neuroectoderm pax2a expression decreased distribution, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image from Li et al., 2019
whole organism elavl3 expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
diencephalon decreased size, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image from Li et al., 2019
neural plate cell Ab36-h3 labeling absent, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
thalamus decreased size, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
telencephalon decreased size, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image from Li et al., 2019
whole organism etv1 expression decreased amount, abnormal WT + MO7-sox19b standard conditions Fig. 5 with image from Li et al., 2019
whole organism ascl1a expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
neural plate neurog1 expression increased distribution, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
axis decreased length, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
head decreased size, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
neural plate elavl3 expression increased distribution, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism cdkn1bb expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism fgf3 expression decreased amount, abnormal WT + MO7-sox19b standard conditions Fig. 5 with image from Li et al., 2019
whole organism ezh2 expression decreased amount, abnormal WT + MO7-sox19b standard conditions Fig. 7 with image from Li et al., 2019
caudal fin curved dorsal, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image,  Fig. 5 with image from Li et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
notochord morphology, abnormal WT + MO7-sox19b standard conditions Fig. 3 with image from Li et al., 2019
whole organism her3 expression decreased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
forebrain ventricle distended, abnormal WT + MO7-sox19b standard conditions Fig. 3 with image from Li et al., 2019
whole organism cdkn1ca expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism isl1a expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
neuroectoderm anterior region otx2b expression decreased distribution, abnormal WT + MO7-sox19b standard conditions Fig. 2 with image from Li et al., 2019
neural plate isl1a expression increased distribution, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism neurog1 expression increased amount, abnormal WT + MO7-sox19b standard conditions Fig. 4 with image,  Fig. 5 with image from Li et al., 2019
neural crest cell development decreased process quality, abnormal WT + MO7-sox19b standard conditions Fig. 3 with image from Li et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.