Morpholino

MO1-bif1.1

ID

ZDB-MRPHLNO-191227-1

Name

MO1-bif1.1

Previous Names

None

Target

Sequence

5' - ATCCTCATCTGTGGAAAGATTAGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bif1.1

Expressed Gene	Anatomy	Figures
gata1a	(not) caudal hematopoietic tissue	Fig. 4 from Ghersi et al., 2019
gata2b	dorsal aorta	Fig. 4 from Ghersi et al., 2019
kdrl	blood vasculature	Fig. S5 from Ghersi et al., 2019
mpx	intermediate cell mass of mesoderm	Fig. S5 from Ghersi et al., 2019
myb	(not) caudal hematopoietic tissue	Fig. 4 from Ghersi et al., 2019
rag1	(not) thymus	Fig. 4 from Ghersi et al., 2019
runx1	dorsal aorta	Fig. 4 from Ghersi et al., 2019

Phenotype

Phenotype resulting from MO1-bif1.1

Phenotype	Fish	Figures
caudal hematopoietic tissue gata1a expression absent, abnormal	AB + MO1-bif1.1	Fig. 4 from Ghersi et al., 2019
caudal hematopoietic tissue myb expression absent, abnormal	AB + MO1-bif1.1	Fig. 4 from Ghersi et al., 2019
caudal hematopoietic tissue myb expression decreased amount, abnormal	AB + MO1-bif1.1	Fig. 4 from Ghersi et al., 2019
caudal hematopoietic tissue cell death increased occurrence, abnormal	sd2Tg + MO1-bif1.1	Fig. S6 from Ghersi et al., 2019
dorsal aorta runx1 expression decreased amount, abnormal	AB + MO1-bif1.1	Fig. 4 from Ghersi et al., 2019
eye decreased size, abnormal	AB + MO1-bif1.1	Fig. 5 from Ghersi et al., 2019
intermediate cell mass of mesoderm mpx expression decreased amount, abnormal	AB + MO1-bif1.1	Fig. S5 from Ghersi et al., 2019
nucleate erythrocyte decreased amount, abnormal	AB + MO1-bif1.1	Fig. 4 from Ghersi et al., 2019
thymus rag1 expression absent, abnormal	AB + MO1-bif1.1	Fig. 4 from Ghersi et al., 2019

Phenotype of all Fish created by or utilizing MO1-bif1.1

Phenotype	Fish	Conditions	Figures
caudal hematopoietic tissue myb expression decreased amount, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 4 from Ghersi et al., 2019
thymus rag1 expression absent, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 4 from Ghersi et al., 2019
dorsal aorta runx1 expression decreased amount, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 4 from Ghersi et al., 2019
caudal hematopoietic tissue myb expression absent, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 4 from Ghersi et al., 2019
eye decreased size, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 5 from Ghersi et al., 2019
nucleate erythrocyte decreased amount, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 4 from Ghersi et al., 2019
caudal hematopoietic tissue gata1a expression absent, abnormal	AB + MO1-bif1.1	standard conditions	Fig. 4 from Ghersi et al., 2019
intermediate cell mass of mesoderm mpx expression decreased amount, abnormal	AB + MO1-bif1.1	standard conditions	Fig. S5 from Ghersi et al., 2019
caudal hematopoietic tissue cell death increased occurrence, abnormal	sd2Tg + MO1-bif1.1	standard conditions	Fig. S6 from Ghersi et al., 2019

Citations