Morpholino

MO1-fsd1

ID
ZDB-MRPHLNO-190708-1
Name
MO1-fsd1
Previous Names
  • Fs1-aMO (1)
Target
Sequence
5' - ACTCCTTCTGGTCGTCCATGCTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fsd1
Expressed Gene Anatomy Figures
gata1a Fig. 5 with image from Liu et al., 2019
gata2b Fig. 5 with image from Liu et al., 2019
gfi1aa Fig. 5 with image from Liu et al., 2019
myb Fig. 3 with image from Liu et al., 2019
myl7 Fig. S2 with image from Tu et al., 2018
notch1a Fig. 6 with image from Liu et al., 2019
rag1 Fig. 5 with image from Liu et al., 2019
runx1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
spaw Fig. 1 with image from Tu et al., 2018
spi1b Fig. 5 with image from Liu et al., 2019
Phenotype
Phenotype resulting from MO1-fsd1
Phenotype Fish Figures
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-fsd1 Fig. 2 with image from Liu et al., 2019
blood vessel cilium decreased length, abnormal hsc5Tg; pku6Tg + MO1-fsd1 Fig. 2 with image from Liu et al., 2019
caudal hematopoietic tissue spi1b expression decreased amount, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
caudal hematopoietic tissue gata1a expression decreased amount, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
caudal hematopoietic tissue gata1a expression decreased distribution, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
caudal hematopoietic tissue spi1b expression decreased distribution, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
determination of heart left/right asymmetry process quality, abnormal AB + MO1-fsd1 Fig. S2 with image from Tu et al., 2018
determination of left/right symmetry process quality, abnormal AB + MO1-fsd1 Fig. 1 with image from Tu et al., 2018
heart tube mislocalised, abnormal AB + MO1-fsd1 Fig. S2 with image from Tu et al., 2018
hematopoietic cell notch1a expression decreased amount, abnormal ioz1Tg; pku6Tg + MO1-fsd1 Fig. 6 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-fsd1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
hemopoiesis decreased occurrence, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-fsd1 Fig. 1 with image from Tu et al., 2018
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-fsd1 Fig. 1 with image from Tu et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-fsd1 Fig. 1 with image from Tu et al., 2018
pericardium edematous, abnormal AB + MO1-fsd1 Fig. 1 with image from Tu et al., 2018
thymus rag1 expression decreased amount, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-fsd1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta gata2b expression decreased amount, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-fsd1 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta gfi1aa expression decreased amount, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta gata2b expression decreased distribution, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta gfi1aa expression decreased distribution, abnormal AB + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-fsd1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-fsd1 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal ioz1Tg; pku6Tg + MO1-fsd1 Fig. 5 with image from Liu et al., 2019
whole organism runx1 expression decreased amount, abnormal AB + MO1-fsd1 Fig. 3 with image from Liu et al., 2019
whole organism increased curvature, abnormal AB + MO1-fsd1 Fig. 1 with image from Tu et al., 2018
Phenotype of all Fish created by or utilizing MO1-fsd1
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-fsd1 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-fsd1 standard conditions Fig. 1 with image from Tu et al., 2018
ventral wall of dorsal aorta gata2b expression decreased distribution, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-fsd1 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 3 with image from Liu et al., 2019
heart tube mislocalised, abnormal AB + MO1-fsd1 standard conditions Fig. S2 with image from Tu et al., 2018
ventral wall of dorsal aorta gata2b expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
whole organism runx1 expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta gfi1aa expression decreased distribution, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-fsd1 control Fig. 3 with image from Liu et al., 2019
hemopoiesis decreased occurrence, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
whole organism increased curvature, abnormal AB + MO1-fsd1 standard conditions Fig. 1 with image from Tu et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-fsd1 control Fig. 1 with image from Tu et al., 2018
caudal hematopoietic tissue spi1b expression decreased distribution, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta gfi1aa expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-fsd1 standard conditions Fig. 1 with image from Tu et al., 2018
pericardium edematous, abnormal AB + MO1-fsd1 standard conditions Fig. 1 with image from Tu et al., 2018
determination of left/right symmetry process quality, abnormal AB + MO1-fsd1 standard conditions Fig. 1 with image from Tu et al., 2018
caudal hematopoietic tissue gata1a expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
caudal hematopoietic tissue gata1a expression decreased distribution, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
thymus rag1 expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
determination of heart left/right asymmetry process quality, abnormal AB + MO1-fsd1 standard conditions Fig. S2 with image from Tu et al., 2018
caudal hematopoietic tissue spi1b expression decreased amount, abnormal AB + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
blood vessel cilium decreased length, abnormal hsc5Tg; pku6Tg + MO1-fsd1 control Fig. 2 with image from Liu et al., 2019
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-fsd1 control Fig. 2 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal ioz1Tg; pku6Tg + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal ioz1Tg; pku6Tg + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
hematopoietic cell notch1a expression decreased amount, abnormal ioz1Tg; pku6Tg + MO1-fsd1 control Fig. 6 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal pku6Tg; zf169Tg + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal pku6Tg; zf169Tg + MO1-fsd1 control Fig. 5 with image from Liu et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.