Morpholino

MO1-pla2g6

ID
ZDB-MRPHLNO-190207-3
Name
MO1-pla2g6
Previous Names
None
Target
Sequence
5' - TTGCTCTGAAAGAAACACAATGCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. Sequence was provided by authors.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pla2g6
No data available
Phenotype
Phenotype resulting from MO1-pla2g6
Phenotype Fish Figures
brain pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 1 from Sánchez et al., 2018
brain malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 1 from Sánchez et al., 2018
diencephalon th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
diencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
endohypothalamic tract th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
forebrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
forebrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4Fig. 5 from Sánchez et al., 2018
forebrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4Fig. 5 from Sánchez et al., 2018
habenula sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
hindbrain has fewer parts of type cranial motor neuron, abnormal vu12Tg + MO1-pla2g6 + MO4-tp53 Fig. 3 from Sánchez et al., 2018
hindbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
hindbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
hypothalamus posterior region th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
locus coeruleus th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
medulla oblongata th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
midbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
midbrain has fewer parts of type cranial motor neuron, abnormal vu12Tg + MO1-pla2g6 + MO4-tp53 Fig. 3 from Sánchez et al., 2018
midbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
midbrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4Fig. 5 from Sánchez et al., 2018
midbrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4Fig. 5 from Sánchez et al., 2018
olfactory bulb th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
peripheral nervous system has fewer parts of type peripheral neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4 from Sánchez et al., 2018
post-vent region curled, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 1 from Sánchez et al., 2018
posterior lateral line ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
pretectum th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
spinal cord malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4 from Sánchez et al., 2018
statoacoustic (VIII) ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
telencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
trigeminal ganglion decondensed, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4 from Sánchez et al., 2018
trigeminal ganglion disorganized, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 5 from Sánchez et al., 2018
trigeminal ganglion increased length, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4 from Sánchez et al., 2018
trigeminal ganglion increased width, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 4 from Sánchez et al., 2018
whole organism lmna expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism sptbn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
whole organism atp1a3a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism grin1b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism unc13a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism kif5c expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism adar expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism huwe1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism agrn expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism xpr1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism cacna2d4b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism npc1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism slc6a3 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism slc2a1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism th2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
whole organism pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 1 from Sánchez et al., 2018
whole organism decreased size, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 1 from Sánchez et al., 2018
whole organism hsp70l expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism ccng1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism casp8 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism hspb1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism hsp90aa1.2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism uchl1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
whole organism sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 Fig. 7 from Sánchez et al., 2018
Phenotype of all Fish created by or utilizing MO1-pla2g6
Phenotype Fish Conditions Figures
forebrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
post-vent region curled, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
whole organism hsp70l expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
peripheral nervous system has fewer parts of type peripheral neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism xpr1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
midbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion disorganized, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 5 from Sánchez et al., 2018
whole organism th2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism unc13a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
hindbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
forebrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism lmna expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism adar expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
midbrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
whole organism sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
medulla oblongata th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion increased width, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
endohypothalamic tract th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism grin1b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism hspb1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
pretectum th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
locus coeruleus th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
diencephalon th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
midbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism slc6a3 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
hypothalamus posterior region th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism npc1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
trigeminal ganglion decondensed, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism cacna2d4b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism hsp90aa1.2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism mfn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
spinal cord malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism ccng1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
brain malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
posterior lateral line ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
midbrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
olfactory bulb th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism slc2a1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
whole organism uchl1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism agrn expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism sptbn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
statoacoustic (VIII) ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
telencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism kif5c expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
brain pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
whole organism huwe1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
habenula sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism casp8 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
hindbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism atp1a3a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
diencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
forebrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
whole organism decreased size, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
trigeminal ganglion increased length, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
hindbrain has fewer parts of type cranial motor neuron, abnormal vu12Tg + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 3 from Sánchez et al., 2018
midbrain has fewer parts of type cranial motor neuron, abnormal vu12Tg + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 3 from Sánchez et al., 2018
Citations