Morpholino

MO1-caspb

ID

ZDB-MRPHLNO-181107-1

Name

MO1-caspb

Previous Names

None

Target

caspb (1)

Sequence

5' - CTGGGTAATATCCTCCATTTTCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-caspb

No data available

Phenotype

Phenotype resulting from MO1-caspb

No data available

Phenotype of all Fish created by or utilizing MO1-caspb

Phenotype	Fish	Conditions	Figures
whole organism ifng1 expression amount, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
whole organism il6 expression increased amount, abnormal	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
pericardial region edematous, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
whole organism il10 expression amount, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
whole organism decreased life span, abnormal	AB + MO1-caspb	bacterial treatment by exposure to environment: Edwardsiella piscicida	Fig. 6 from Yang et al., 2018
fin eroding, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
trunk morphology, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
defense response to bacterium decreased efficacy, abnormal	AB + MO1-caspb	bacterial treatment by exposure to environment: Edwardsiella piscicida	Fig. 6 from Yang et al., 2018
whole organism decreased life span, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
whole organism il1b expression amount, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
caudal fin morphology, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
whole organism cxcl8a expression amount, ameliorated	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
gut inflammatory response increased process quality, abnormal	AB + MO1-caspb	bacterial treatment by exposure to environment: Edwardsiella piscicida	Fig. 6 from Yang et al., 2018
whole organism il10 expression increased amount, abnormal	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018
whole organism ifng1 expression increased amount, abnormal	AB + MO1-caspb	chemical treatment by environment: lipopolysaccharide	Fig. S10 from Yang et al., 2018

Citations