ZFIN ID: ZDB-MRPHLNO-180711-1
Morpholino Name: MO10-vegfaa
Target: vegfaa (1)
Sequence:
5' - CATAGACTTTAACAGACATACCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO10-vegfaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO10-vegfaa No data available
PHENOTYPE
Phenotype resulting from MO10-vegfaa
Phenotype Figures
caudal fin blood accumulation caudal fin, abnormal Fig. 4 with image from Müller-Deile et al., 2018
glomerular filtration disrupted, abnormal Fig. 4 from Müller-Deile et al., 2017
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal Fig. 4 with image from Müller-Deile et al., 2018
optic choroid vascular plexus EGFP expression decreased amount, abnormal Fig. 4 from Müller-Deile et al., 2017
pericardium edematous, abnormal Fig. 4 from Müller-Deile et al., 2017
post-vent vasculature morphology, abnormal Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood circulation decreased occurrence, abnormal Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood plasma EGFP expression decreased amount, abnormal Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature intersegmental vessel morphology, abnormal Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus morphology, abnormal Fig. 6 with image from Müller-Deile et al., 2018
pronephric glomerulus endothelial cell swollen, abnormal Fig. 4 from Müller-Deile et al., 2017
pronephric podocyte morphology, abnormal Fig. 6 with image from Müller-Deile et al., 2018
retina blood plasma EGFP expression decreased amount, abnormal Fig. 3 with image from Müller-Deile et al., 2018
retina blood vessel EGFP expression decreased amount, abnormal Fig. 3 with image from Müller-Deile et al., 2018
whole organism ab1-vegf labeling decreased amount, abnormal Fig. 4 with image from Müller-Deile et al., 2018
whole organism edematous, abnormal Fig. 2 with image from Müller-Deile et al., 2018
yolk syncytial layer edematous, abnormal Fig. 4 from Müller-Deile et al., 2017

Phenotype of all Fish created by or utilizing MO10-vegfaa
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
post-vent vasculature blood circulation decreased occurrence, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus morphology, abnormal WT + MO10-vegfaa standard conditions Fig. 6 with image from Müller-Deile et al., 2018
whole organism ab1-vegf labeling decreased amount, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus endothelial cell swollen, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
pronephric podocyte morphology, abnormal WT + MO10-vegfaa standard conditions Fig. 6 with image from Müller-Deile et al., 2018
caudal fin blood accumulation caudal fin, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
whole organism edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 2 with image from Müller-Deile et al., 2018
yolk syncytial layer edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
glomerular filtration disrupted, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
retina blood plasma EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 3 with image from Müller-Deile et al., 2018
retina blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 3 with image from Müller-Deile et al., 2018
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood plasma EGFP expression decreased amount, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature intersegmental vessel morphology, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature morphology, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
Genome Resources:
CITATIONS (2)