Morpholino

MO10-vegfaa

ID
ZDB-MRPHLNO-180711-1
Name
MO10-vegfaa
Previous Names
None
Target
Sequence
5' - CATAGACTTTAACAGACATACCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO10-vegfaa
No data available
Phenotype
Phenotype resulting from MO10-vegfaa
Phenotype Fish Figures
caudal fin blood accumulation caudal fin, abnormal WT + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
glomerular filtration disrupted, abnormal lri500Tg + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal lri500Tg; zf2134Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
pericardium edematous, abnormal WT + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
post-vent vasculature morphology, abnormal lri500Tg; zf2134Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood circulation decreased occurrence, abnormal WT + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood plasma EGFP expression decreased amount, abnormal lri500Tg; zf2134Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature intersegmental vessel morphology, abnormal lri500Tg; zf2134Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus morphology, abnormal WT + MO10-vegfaa Fig. 6 with image from Müller-Deile et al., 2018
pronephric glomerulus endothelial cell swollen, abnormal WT + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
pronephric podocyte morphology, abnormal WT + MO10-vegfaa Fig. 6 with image from Müller-Deile et al., 2018
retina blood plasma EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa Fig. 3 with image from Müller-Deile et al., 2018
retina blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa Fig. 3 with image from Müller-Deile et al., 2018
whole organism ab1-vegf labeling decreased amount, abnormal WT + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
whole organism edematous, abnormal WT + MO10-vegfaa Fig. 2 with image from Müller-Deile et al., 2018
yolk syncytial layer edematous, abnormal WT + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
Phenotype of all Fish created by or utilizing MO10-vegfaa
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
post-vent vasculature blood circulation decreased occurrence, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus morphology, abnormal WT + MO10-vegfaa standard conditions Fig. 6 with image from Müller-Deile et al., 2018
whole organism ab1-vegf labeling decreased amount, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus endothelial cell swollen, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
pronephric podocyte morphology, abnormal WT + MO10-vegfaa standard conditions Fig. 6 with image from Müller-Deile et al., 2018
caudal fin blood accumulation caudal fin, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
whole organism edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 2 with image from Müller-Deile et al., 2018
yolk syncytial layer edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
glomerular filtration disrupted, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
retina blood plasma EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 3 with image from Müller-Deile et al., 2018
retina blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 3 with image from Müller-Deile et al., 2018
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal lri500Tg; zf2134Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood plasma EGFP expression decreased amount, abnormal lri500Tg; zf2134Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature intersegmental vessel morphology, abnormal lri500Tg; zf2134Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature morphology, abnormal lri500Tg; zf2134Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.