Morpholino

MO10-vegfaa

ID
ZDB-MRPHLNO-180711-1
Name
MO10-vegfaa
Previous Names
None
Target
Sequence
5' - CATAGACTTTAACAGACATACCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO10-vegfaa
No data available
Phenotype
Phenotype resulting from MO10-vegfaa
Phenotype Fish Figures
caudal fin blood accumulation caudal fin, abnormal WT + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
glomerular filtration disrupted, abnormal lri500Tg + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
pericardium edematous, abnormal WT + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
post-vent vasculature morphology, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood circulation decreased occurrence, abnormal WT + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood plasma EGFP expression decreased amount, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature intersegmental vessel morphology, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus morphology, abnormal WT + MO10-vegfaa Fig. 6 with image from Müller-Deile et al., 2018
pronephric glomerulus endothelial cell swollen, abnormal WT + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
pronephric podocyte morphology, abnormal WT + MO10-vegfaa Fig. 6 with image from Müller-Deile et al., 2018
retina blood plasma EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa Fig. 3 with image from Müller-Deile et al., 2018
retina blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa Fig. 3 with image from Müller-Deile et al., 2018
whole organism ab1-vegf labeling decreased amount, abnormal WT + MO10-vegfaa Fig. 4 with image from Müller-Deile et al., 2018
whole organism edematous, abnormal WT + MO10-vegfaa Fig. 2 with image from Müller-Deile et al., 2018
yolk syncytial layer edematous, abnormal WT + MO10-vegfaa Fig. 4 from Müller-Deile et al., 2017
Phenotype of all Fish created by or utilizing MO10-vegfaa
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
post-vent vasculature blood circulation decreased occurrence, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
pronephric glomerulus morphology, abnormal WT + MO10-vegfaa standard conditions Fig. 6 with image from Müller-Deile et al., 2018
whole organism ab1-vegf labeling decreased amount, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
pronephric podocyte morphology, abnormal WT + MO10-vegfaa standard conditions Fig. 6 with image from Müller-Deile et al., 2018
pronephric glomerulus endothelial cell swollen, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
caudal fin blood accumulation caudal fin, abnormal WT + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
whole organism edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 2 with image from Müller-Deile et al., 2018
yolk syncytial layer edematous, abnormal WT + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
glomerular filtration disrupted, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 4 from Müller-Deile et al., 2017
retina blood plasma EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 3 with image from Müller-Deile et al., 2018
retina blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO10-vegfaa standard conditions Fig. 3 with image from Müller-Deile et al., 2018
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature blood plasma EGFP expression decreased amount, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature intersegmental vessel morphology, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
post-vent vasculature morphology, abnormal zf2134Tg ; lri500Tg + MO10-vegfaa standard conditions Fig. 4 with image from Müller-Deile et al., 2018
Citations