ZFIN ID: ZDB-MRPHLNO-171205-1
Morpholino Name: MO3-mcu
Target: mcu (1)
Sequence:
5' - CATCAAGAGTAAAGCACTGACCTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. Published sequence contained a typo.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-mcu No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-mcu
Expressed Gene Anatomy Figures
mcu Fig. 1 with image from Soman et al., 2017
th Fig. 2 with image from Soman et al., 2017
PHENOTYPE
Phenotype resulting from MO3-mcu
Phenotype Figures
whole organism mcu expression decreased amount, abnormal Fig. 1 with image from Soman et al., 2017

Phenotype of all Fish created by or utilizing MO3-mcu
Phenotype Fish Conditions Figures
whole organism mcu expression decreased amount, abnormal WT + MO3-mcu standard conditions Fig. 1 with image from Soman et al., 2017
diencephalon has number of diencephalon dopaminergic neuron, ameliorated pink1sh397/sh397 + MO3-mcu standard conditions Fig. 2 with image from Soman et al., 2017
whole organism NADH dehydrogenase (ubiquinone) activity occurrence, ameliorated pink1sh397/sh397 + MO3-mcu standard conditions Fig. 2 with image from Soman et al., 2017
OTHER MO3-mcu MORPHOLINO PAGESNo links to external sites
CITATIONS (1)