Morpholino

MO5-insm1a

ID
ZDB-MRPHLNO-171018-2
Name
MO5-insm1a
Previous Names
None
Target
Sequence
5' - AAATCCTCTGGGCATCTTCGCCAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-insm1a
Expressed Gene Anatomy Figures
ascl1a Fig. S5 from Gong et al., 2017
ascl1b Fig. S5 from Gong et al., 2017
isl2a Fig. S5 from Gong et al., 2017
mnx2a Fig. S5 from Gong et al., 2017
mnx2b Fig. S5 from Gong et al., 2017
neurog3 Fig. S5 from Gong et al., 2017
nkx6.1 Fig. 5 with image from Gong et al., 2017
olig2 Fig. 5 with image from Gong et al., 2017
shha Fig. S5 from Gong et al., 2017
Phenotype
Phenotype resulting from MO5-insm1a
Phenotype Fish Figures
CaP motoneuron decreased amount, abnormal ml2Tg + MO5-insm1a Fig. S4 with image from Gong et al., 2017
CaP motoneuron distance CaP motoneuron, abnormal ml2Tg + MO5-insm1a Fig. S4 with image from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal AB + MO5-insm1a Fig. 5 with image,  Fig. S4 with image from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal AB + MO5-insm1a Fig. 5 with image,  Fig. S4 with image from Gong et al., 2017
MiP motor neuron decreased amount, abnormal ml2Tg + MO5-insm1a Fig. S4 with image from Gong et al., 2017
myoseptum cxcl12a expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 5 with image from He et al., 2017
neuromast spatial pattern, abnormal zf106Tg + MO4-tp53 + MO5-insm1a Fig. 2 with image from He et al., 2017
neuromast hair cell decreased amount, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 3 with image from He et al., 2017
neuromast hair cell development disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 3 with image from He et al., 2017
neuron undifferentiated, abnormal ml2Tg + MO5-insm1a Fig. 3 with image from Gong et al., 2017
neuron differentiation decreased process quality, abnormal ml2Tg + MO5-insm1a Fig. 3 with image from Gong et al., 2017
posterior lateral line neuromast hair cell morphogenesis disrupted, abnormal zf106Tg + MO4-tp53 + MO5-insm1a Fig. 2 with image from He et al., 2017
posterior lateral line primordium ackr3b expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 5 with image from He et al., 2017
posterior lateral line primordium etv4 expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
posterior lateral line primordium decreased size, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 4 with image from He et al., 2017
posterior lateral line primordium cxcr4b expression increased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 5 with image from He et al., 2017
posterior lateral line primordium lef1 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
posterior lateral line primordium axin2 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
posterior lateral line primordium morphology, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 4 with image from He et al., 2017
posterior lateral line primordium cell population proliferation disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 4 with image from He et al., 2017
posterior lateral line primordium neuromast decreased amount, abnormal zf106Tg + MO4-tp53 + MO5-insm1a Fig. 2 with image,  Fig. S2 with image from He et al., 2017
regulation of canonical Wnt signaling pathway disrupted, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
whole organism ascl1b expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism ascl1a expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism nkx6.1 expression decreased amount, abnormal AB + MO5-insm1a Fig. 5 with image from Gong et al., 2017
whole organism isl2a expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism mnx2a expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism mnx2b expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism olig2 expression decreased amount, abnormal AB + MO5-insm1a Fig. 5 with image from Gong et al., 2017
whole organism isl2a expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism ascl1a expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism mnx2a expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism shha expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
Phenotype of all Fish created by or utilizing MO5-insm1a
Phenotype Fish Conditions Figures
whole organism mnx2b expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism ascl1a expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism ascl1b expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism ascl1a expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism nkx6.1 expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
whole organism shha expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism olig2 expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
whole organism mnx2a expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism isl2a expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism mnx2a expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism isl2a expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
posterior lateral line primordium cxcr4b expression increased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
myoseptum cxcl12a expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
posterior lateral line primordium lef1 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium axin2 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium etv4 expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium ackr3b expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
regulation of canonical Wnt signaling pathway disrupted, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
MiP motor neuron decreased amount, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
CaP motoneuron decreased amount, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
neuron undifferentiated, abnormal ml2Tg + MO5-insm1a standard conditions Fig. 3 with image from Gong et al., 2017
CaP motoneuron distance CaP motoneuron, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
neuron differentiation decreased process quality, abnormal ml2Tg + MO5-insm1a standard conditions Fig. 3 with image from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
posterior lateral line primordium cell population proliferation disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
neuromast hair cell decreased amount, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 3 with image from He et al., 2017
posterior lateral line primordium morphology, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
posterior lateral line primordium decreased size, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
neuromast hair cell development disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 3 with image from He et al., 2017
neuromast spatial pattern, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image from He et al., 2017
posterior lateral line primordium neuromast decreased amount, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image,  Fig. S2 with image from He et al., 2017
posterior lateral line neuromast hair cell morphogenesis disrupted, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image from He et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.