Morpholino
MO5-insm1a
- ID
- ZDB-MRPHLNO-171018-2
- Name
- MO5-insm1a
- Previous Names
- None
- Target
- Sequence
-
5' - AAATCCTCTGGGCATCTTCGCCAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-insm1a
Expressed Gene | Anatomy | Figures |
---|---|---|
ascl1a |
Fig. S5
from Gong et al., 2017 |
|
ascl1b |
Fig. S5
from Gong et al., 2017 |
|
isl2a |
Fig. S5
from Gong et al., 2017 |
|
mnx2a |
Fig. S5
from Gong et al., 2017 |
|
mnx2b |
Fig. S5
from Gong et al., 2017 |
1 - 5 of 9 Show all
Phenotype
Phenotype resulting from MO5-insm1a
1 - 5 of 33 Show all
Phenotype of all Fish created by or utilizing MO5-insm1a
1 - 5 of 35 Show all
Citations
- Gong, J., Wang, X., Zhu, C., Dong, X., Zhang, Q., Wang, X., Duan, X., Qian, F., Shi, Y., Gao, Y., Zhao, Q., Chai, R., Liu, D. (2017) Insm1a Regulates Motor Neuron Development in Zebrafish. Frontiers in molecular neuroscience. 10:274
- He, Y., Lu, X., Qian, F., Liu, D., Chai, R., Li, H. (2017) Insm1a Is Required for Zebrafish Posterior Lateral Line Development.. Frontiers in molecular neuroscience. 10:241
1 - 2 of 2
Show