Morpholino

MO1-vwc2

ID
ZDB-MRPHLNO-170613-3
Name
MO1-vwc2
Previous Names
  • brorin MO1 (1)
Target
Sequence
5' - ATGGAGACACCTAGAAGAACAAACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vwc2
Expressed Gene Anatomy Figures
ascl1a Fig. 7 with image from Miyake et al., 2017
axin2 Fig. 4 with image from Miyake et al., 2017
dlx2a Fig. 6 with image from Miyake et al., 2017
emx1 Fig. 6 with image from Miyake et al., 2017
gad1b Fig. 7 with image from Miyake et al., 2017
glula Fig. 7 with image from Miyake et al., 2017
neurog1 Fig. 7 with image from Miyake et al., 2017
ntn1a Fig. 9 with image from Miyake et al., 2017
plp1a Fig. 7 with image from Miyake et al., 2017
sema3d Fig. 9 with image from Miyake et al., 2017
shha Fig. 6 with image from Miyake et al., 2017
tbr1b Fig. 6 with image from Miyake et al., 2017
vwc2 Fig. 3 with image from Miyake et al., 2017
Phenotype
Phenotype resulting from MO1-vwc2
Phenotype Fish Figures
anterior commissure central nervous system projection neuron axonogenesis decreased occurrence, abnormal WT + MO1-vwc2 Fig. 8 with image from Miyake et al., 2017
brain astrocyte glula expression increased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
brain astrocyte development increased occurrence, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
brain BMP signaling pathway increased occurrence, abnormal WT + MO1-vwc2 Fig. 4 with image from Miyake et al., 2017
brain dorsal region ab1-smad labeling increased amount, abnormal WT + MO1-vwc2 Fig. 4 with image from Miyake et al., 2017
brain oligodendrocyte plp1a expression decreased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
brain oligodendrocyte development decreased occurrence, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
brain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 Fig. 3 with image from Miyake et al., 2017
diencephalon sema3d expression decreased amount, abnormal WT + MO1-vwc2 Fig. 9 with image from Miyake et al., 2017
diencephalon GABAergic neuron ascl1a expression decreased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
diencephalon neuron differentiation decreased process quality, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
diencephalon ventral region neurog1 expression decreased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
dorsal telencephalon forebrain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
forebrain lacks all parts of type anterior commissure, abnormal WT + MO1-vwc2 Fig. 8 with image from Miyake et al., 2017
forebrain lacks all parts of type supraoptic tract, abnormal WT + MO1-vwc2 Fig. 8 with image from Miyake et al., 2017
forebrain lacks all parts of type postoptic commissure, abnormal WT + MO1-vwc2 Fig. 8 with image from Miyake et al., 2017
forebrain GABAergic neuron differentiation decreased process quality, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
nucleus of the tract of the postoptic commissure GABAergic neuron gad1b expression decreased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
postoptic commissure central nervous system projection neuron axonogenesis decreased occurrence, abnormal WT + MO1-vwc2 Fig. 8 with image from Miyake et al., 2017
supraoptic tract central nervous system projection neuron axonogenesis decreased occurrence, abnormal WT + MO1-vwc2 Fig. 8 with image from Miyake et al., 2017
tectal ventricle malformed, abnormal WT + MO1-vwc2 Fig. 3 with image from Miyake et al., 2017
telencephalon ntn1a expression increased amount, abnormal WT + MO1-vwc2 Fig. 9 with image from Miyake et al., 2017
telencephalon diencephalon boundary malformed, abnormal WT + MO1-vwc2 Fig. 3 with image from Miyake et al., 2017
ventral telencephalon dlx2a expression decreased amount, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
ventral telencephalon tbr1b expression mislocalised, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
ventral telencephalon emx1 expression mislocalised, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
ventral telencephalon forebrain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
ventral telencephalon GABAergic neuron ascl1a expression decreased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
ventral telencephalon GABAergic neuron gad1b expression decreased amount, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
ventral telencephalon neuron differentiation decreased process quality, abnormal WT + MO1-vwc2 Fig. 7 with image from Miyake et al., 2017
ventral thalamus dlx2a expression decreased amount, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
ventral thalamus ntn1a expression increased amount, abnormal WT + MO1-vwc2 Fig. 9 with image from Miyake et al., 2017
ventral thalamus forebrain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 Fig. 6 with image from Miyake et al., 2017
whole organism vwc2 expression decreased amount, abnormal WT + MO1-vwc2 Fig. 3 with image from Miyake et al., 2017
Phenotype of all Fish created by or utilizing MO1-vwc2
Phenotype Fish Conditions Figures
ventral thalamus forebrain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
anterior commissure central nervous system projection neuron axonogenesis decreased occurrence, abnormal WT + MO1-vwc2 standard conditions Fig. 8 with image from Miyake et al., 2017
brain oligodendrocyte development decreased occurrence, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
postoptic commissure central nervous system projection neuron axonogenesis decreased occurrence, abnormal WT + MO1-vwc2 standard conditions Fig. 8 with image from Miyake et al., 2017
forebrain GABAergic neuron differentiation decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
brain astrocyte development increased occurrence, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
tectal ventricle malformed, abnormal WT + MO1-vwc2 standard conditions Fig. 3 with image from Miyake et al., 2017
ventral thalamus ntn1a expression increased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 9 with image from Miyake et al., 2017
telencephalon diencephalon boundary malformed, abnormal WT + MO1-vwc2 standard conditions Fig. 3 with image from Miyake et al., 2017
supraoptic tract central nervous system projection neuron axonogenesis decreased occurrence, abnormal WT + MO1-vwc2 standard conditions Fig. 8 with image from Miyake et al., 2017
ventral thalamus dlx2a expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
ventral telencephalon emx1 expression mislocalised, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
brain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 3 with image from Miyake et al., 2017
ventral telencephalon dlx2a expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
telencephalon ntn1a expression increased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 9 with image from Miyake et al., 2017
ventral telencephalon forebrain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
dorsal telencephalon forebrain morphogenesis decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
diencephalon neuron differentiation decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
nucleus of the tract of the postoptic commissure GABAergic neuron gad1b expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
ventral telencephalon GABAergic neuron ascl1a expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
forebrain lacks all parts of type supraoptic tract, abnormal WT + MO1-vwc2 standard conditions Fig. 8 with image from Miyake et al., 2017
brain oligodendrocyte plp1a expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
diencephalon ventral region neurog1 expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
brain astrocyte glula expression increased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
whole organism vwc2 expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 3 with image from Miyake et al., 2017
forebrain lacks all parts of type postoptic commissure, abnormal WT + MO1-vwc2 standard conditions Fig. 8 with image from Miyake et al., 2017
diencephalon sema3d expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 9 with image from Miyake et al., 2017
ventral telencephalon tbr1b expression mislocalised, abnormal WT + MO1-vwc2 standard conditions Fig. 6 with image from Miyake et al., 2017
ventral telencephalon GABAergic neuron gad1b expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
ventral telencephalon neuron differentiation decreased process quality, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
brain BMP signaling pathway increased occurrence, abnormal WT + MO1-vwc2 standard conditions Fig. 4 with image from Miyake et al., 2017
diencephalon GABAergic neuron ascl1a expression decreased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 7 with image from Miyake et al., 2017
brain dorsal region ab1-smad labeling increased amount, abnormal WT + MO1-vwc2 standard conditions Fig. 4 with image from Miyake et al., 2017
forebrain lacks all parts of type anterior commissure, abnormal WT + MO1-vwc2 standard conditions Fig. 8 with image from Miyake et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.