ZFIN ID: ZDB-MRPHLNO-170502-1
Morpholino Name: MO9-vegfaa
Target: vegfaa (1)
Sequence:
5' - GCTGGATTAAAGCTGTCTCACCTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO9-vegfaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO9-vegfaa No data available
PHENOTYPE
Phenotype resulting from MO9-vegfaa
Phenotype of all Fish created by or utilizing MO9-vegfaa
Genome Resources:
CITATIONS (1)