Morpholino

MO3-tnfrsf1a

ID
ZDB-MRPHLNO-161223-1
Name
MO3-tnfrsf1a
Previous Names
None
Target
Sequence
5' - GGAAGCATGAGGAACTTACAGTTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tnfrsf1a
No data available
Phenotype
Phenotype resulting from MO3-tnfrsf1a
No data available
Phenotype of all Fish created by or utilizing MO3-tnfrsf1a
Phenotype Fish Conditions Figures
regenerating fin decreased length, abnormal AB + MO3-tnfrsf1a amputation: caudal fin Fig. 5 with image from Nguyen-Chi et al., 2017
blastema cell population proliferation decreased occurrence, abnormal AB + MO3-tnfrsf1a amputation: caudal fin Fig. 5 with image from Nguyen-Chi et al., 2017
fin regeneration decreased efficacy, abnormal AB + MO3-tnfrsf1a amputation: caudal fin Fig. 5 with image from Nguyen-Chi et al., 2017
granuloma formation decreased occurrence, abnormal WT + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 7 with image from Bernut et al., 2016
whole organism cxcl8a expression amount, ameliorated WT + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 8 with image from Bernut et al., 2016
whole organism decreased life span, abnormal WT + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 2 with image from Bernut et al., 2016
response to bacterium decreased process quality, abnormal WT + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 2 with image from Bernut et al., 2016
neutrophil immune response process quality, abnormal i114Tg + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 6 with image from Bernut et al., 2016
whole organism decreased life span, abnormal i114Tg + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 8 with image from Bernut et al., 2016
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 6 with imageFig. 7 with imageFig. 8 with image from Bernut et al., 2016
neutrophil response to bacterium process quality, abnormal i114Tg + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 6 with imageFig. 7 with imageFig. 8 with image from Bernut et al., 2016
macrophage response to bacterium process quality, abnormal ump2Tg + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 3 with image from Bernut et al., 2016
macrophage immune response process quality, abnormal ump2Tg + MO3-tnfrsf1a bacterial treatment by injection: Mycobacteroides abscessus Fig. 3 with image from Bernut et al., 2016
regenerating fin macrophage decreased amount, abnormal ump2Tg + MO3-tnfrsf1a amputation: caudal fin Fig. 5 with image from Nguyen-Chi et al., 2017
Citations