ZFIN ID: ZDB-MRPHLNO-161207-2
Morpholino Name: MO4-mir9
Targets: mir9-1 (1), mir9-2 (1), mir9-3 (1), mir9-4 (1), mir9-5 (1), mir9-6 (1), mir9-7 (1)
Sequence:
5' - GCTAGATAACCAAAGATAGCAACTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: RNA cleavage blocker morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mir9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mir9 No data available
PHENOTYPE
Phenotype resulting from MO4-mir9
No data available

Phenotype of all Fish created by or utilizing MO4-mir9
No data available
Genome Resources:
CITATIONS (1)