Morpholino

MO1-znf644a

ID
ZDB-MRPHLNO-161116-1
Name
MO1-znf644a
Previous Names
None
Target
Sequence
5' - ATTAAAATTGTCACCTGTTTTGACT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-znf644a
Expressed Gene Anatomy Figures
atoh7 Fig. 3 with image from Olsen et al., 2016
ccnd1 Fig. 3 with image,  Fig. 7 with image from Olsen et al., 2016
lef1 Fig. S3 with image from Olsen et al., 2016
otx2b Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
rx3 Fig. 3 with image from Olsen et al., 2016
vsx2 Fig. 3 with image,  Fig. 5 with image,  Fig. S3 with image from Olsen et al., 2016
Phenotype
Phenotype resulting from MO1-znf644a
Phenotype Fish Figures
amacrine cell ab1-gaba labeling absent, abnormal AB + MO1-znf644a Fig. 4 with image from Olsen et al., 2016
amacrine cell ab1-pax6 labeling absent, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
cell proliferation in midbrain increased occurrence, abnormal AB + MO1-znf644a Fig. 7 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression increased distribution, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
epigenetic regulation of gene expression disrupted, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
eye decreased size, abnormal AB + MO1-znf644a Fig. 2 with image,  Fig. S2 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression mislocalised, abnormal AB + MO1-znf644a Fig. S3 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644a Fig. S3 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal AB + MO1-znf644a Fig. S3 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644a Fig. 7 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-znf644a Fig. 2 with image,  Fig. S2 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 7 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644a Fig. 4 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644a Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retina central region vsx2 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression increased amount, abnormal AB + MO1-znf644a Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression increased amount, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression spatial pattern, abnormal AB + MO1-znf644a Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
retina neuroblast atoh7 expression increased amount, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retina neuroblast atoh7 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 3 with image from Olsen et al., 2016
retinal bipolar neuron ab2-prkcb labeling absent, abnormal AB + MO1-znf644a Fig. 4 with image from Olsen et al., 2016
retinal bipolar neuron ab1-pax6 labeling absent, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression increased distribution, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron nucleus Ab34-h3 labeling absent, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-znf644a Fig. 4 with image from Olsen et al., 2016
retinal ganglion cell ab1-pax6 labeling absent, abnormal AB + MO1-znf644a Fig. 5 with image from Olsen et al., 2016
Phenotype of all Fish created by or utilizing MO1-znf644a
Phenotype Fish Conditions Figures
retina central region vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal AB + MO1-znf644a standard conditions Fig. S3 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression increased distribution, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression increased amount, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
retinal bipolar neuron nucleus Ab34-h3 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
retina neuroblast atoh7 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
cell proliferation in midbrain increased occurrence, abnormal AB + MO1-znf644a standard conditions Fig. 7 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-znf644a standard conditions Fig. 2 with image,  Fig. S2 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression increased amount, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 7 with image from Olsen et al., 2016
epigenetic regulation of gene expression disrupted, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. 7 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image,  Fig. S3 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retinal bipolar neuron ab1-pax6 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retina neuroblast atoh7 expression increased amount, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. S3 with image from Olsen et al., 2016
retinal ganglion cell ab1-pax6 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
eye decreased size, abnormal AB + MO1-znf644a standard conditions Fig. 2 with image,  Fig. S2 with image from Olsen et al., 2016
amacrine cell ab1-pax6 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
retinal bipolar neuron ab2-prkcb labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression increased distribution, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. S3 with image from Olsen et al., 2016
amacrine cell ab1-gaba labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with image,  Fig. S6 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. 6 with image,  Fig. S6 with image from Olsen et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.