Morpholino

MO2-ift74

ID
ZDB-MRPHLNO-161012-11
Name
MO2-ift74
Previous Names
None
Target
Sequence
5' - GTCCTGCAAGAGTCAAGCACAGAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ift74
No data available
Phenotype
Phenotype resulting from MO2-ift74
Phenotype Fish Figures
anterior crista cilium decreased amount, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior crista cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior crista cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior crista cilium decreased length, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior macula cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior macula cilium decreased amount, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior macula cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
anterior macula cilium decreased length, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
eye photoreceptor cell opsin transport decreased rate of continuous process, abnormal ouc2001Tg; ouc2006Tg + MO2-ift74 + MO3-ift74 Fig. S5 from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased amount, abnormal WT + MO2-ift74 Figure 6 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal WT + MO2-ift74 Figure 6 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal WT + MO2-ift74 Figure 6 with image from Zhu et al., 2021
gastrulation disrupted, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
hindbrain cilium decreased amount, abnormal hsc5Tg + MO2-ift74 (TU) Fig. 2 from Luo et al., 2021
hindbrain cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
hindbrain cilium GFP expression decreased amount, abnormal hsc5Tg + MO2-ift74 (TU) Fig. 2 from Luo et al., 2021
hindbrain cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 Fig. 2 from Luo et al., 2021
hindbrain cilium GFP expression decreased distribution, abnormal hsc5Tg + MO2-ift74 (TU) Fig. 2 from Luo et al., 2021
hindbrain cilium decreased length, abnormal hsc5Tg + MO2-ift74 (TU) Fig. 2 from Luo et al., 2021
notochord broad, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
notochord kinked, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
peripheral olfactory organ cilium decreased amount, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
peripheral olfactory organ cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
peripheral olfactory organ cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
post-vent region curved, abnormal WT + MO2-ift74 Figure 1 with image from Zhu et al., 2021
post-vent region curved ventral, abnormal TU + MO2-ift74 Fig. 2,  Fig. S4 from Luo et al., 2021
pronephric duct cilium decreased amount, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
pronephric duct cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
pronephric duct cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
pronephric proximal convoluted tubule dilated, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
pronephric proximal convoluted tubule increased diameter, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal WT + MO2-ift74 Figure 6 with image from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal WT + MO2-ift74 Figure 6 with image from Zhu et al., 2021
somite decreased thickness, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
somite increased width, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
spinal cord cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
spinal cord cilium decreased amount, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
spinal cord cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 Fig. S4 from Luo et al., 2021
trunk anterior-posterior axis shortened, abnormal WT + MO2-ift74 Fig. 4 from Lindstrand et al., 2016
Phenotype of all Fish created by or utilizing MO2-ift74
Phenotype Fish Conditions Figures
pronephric duct cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
anterior macula cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
pronephric duct cilium decreased amount, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
spinal cord cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
spinal cord cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
anterior macula cilium decreased amount, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
anterior crista cilium decreased length, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
anterior crista cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
spinal cord cilium decreased amount, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
hindbrain cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
peripheral olfactory organ cilium decreased amount, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
anterior macula cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
hindbrain cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
peripheral olfactory organ cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
pronephric duct cilium ab1-tuba labeling decreased distribution, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
anterior crista cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
post-vent region curved ventral, abnormal TU + MO2-ift74 control Fig. 2,  Fig. S4 from Luo et al., 2021
peripheral olfactory organ cilium ab1-tuba labeling decreased amount, abnormal TU + MO2-ift74 control Fig. S4 from Luo et al., 2021
anterior crista cilium decreased amount, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
anterior macula cilium decreased length, abnormal TU + MO2-ift74 control Fig. 2 from Luo et al., 2021
somite increased width, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal WT + MO2-ift74 control Figure 6 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal WT + MO2-ift74 control Figure 6 with image from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal WT + MO2-ift74 control Figure 6 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased amount, abnormal WT + MO2-ift74 control Figure 6 with image from Zhu et al., 2021
post-vent region curved, abnormal WT + MO2-ift74 control Figure 1 with image from Zhu et al., 2021
pronephric proximal convoluted tubule dilated, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
pronephric proximal convoluted tubule increased diameter, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
gastrulation disrupted, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
somite decreased thickness, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
notochord broad, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
notochord kinked, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
trunk anterior-posterior axis shortened, abnormal WT + MO2-ift74 standard conditions Fig. 4 from Lindstrand et al., 2016
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal WT + MO2-ift74 control Figure 6 with image from Zhu et al., 2021
post-vent region curved, abnormal WT + MO2-ift74 + MO3-ift74 control Figure 1 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased length, abnormal WT + MO2-ift74 + MO3-ift74 control Figure 6 with image from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal WT + MO2-ift74 + MO3-ift74 control Figure 6 with image from Zhu et al., 2021
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal WT + MO2-ift74 + MO3-ift74 control Figure 6 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium decreased amount, abnormal WT + MO2-ift74 + MO3-ift74 control Figure 6 with image from Zhu et al., 2021
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal WT + MO2-ift74 + MO3-ift74 control Figure 6 with image from Zhu et al., 2021
hindbrain cilium GFP expression decreased distribution, abnormal hsc5Tg + MO2-ift74 (TU) control Fig. 2 from Luo et al., 2021
hindbrain cilium decreased length, abnormal hsc5Tg + MO2-ift74 (TU) control Fig. 2 from Luo et al., 2021
hindbrain cilium GFP expression decreased amount, abnormal hsc5Tg + MO2-ift74 (TU) control Fig. 2 from Luo et al., 2021
hindbrain cilium decreased amount, abnormal hsc5Tg + MO2-ift74 (TU) control Fig. 2 from Luo et al., 2021
eye photoreceptor cell opsin transport decreased rate of continuous process, abnormal ouc2001Tg; ouc2006Tg + MO2-ift74 + MO3-ift74 heat shock Fig. S5 from Zhu et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.