header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160211-4
Morpholino Name: MO4-nr2f1b
Target: nr2f1b (1)
Previous Name: nr2f1b i1e2MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AACCGCTATCAGAACACAGAGAGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-nr2f1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-nr2f1b
Expressed Gene Anatomy Figures
efnb2a Fig. 3 with image from Li et al., 2015
flt4 Fig. 3 with image from Li et al., 2015
mrc1a Fig. 3 with image from Li et al., 2015
notch3 Fig. 3 with image from Li et al., 2015
PHENOTYPE
Phenotype resulting from MO4-nr2f1b
Phenotype Figures
angioblast cell migration decreased process quality, abnormal Fig. 5 with image from Li et al., 2015
blood circulation disrupted, abnormal Fig. S3 with image from Li et al., 2015
dorsal longitudinal anastomotic vessel structure, abnormal Fig. S3 with image from Li et al., 2015
eye decreased size, abnormal Fig. S3 with image from Li et al., 2015
intersegmental vessel decreased length, abnormal Fig. 2 with imageFig. 5 with image from Li et al., 2015
intersegmental vessel incomplete structure, abnormal Fig. 2 with image from Li et al., 2015
intersegmental vessel spatial pattern, abnormal Fig. 2 with image from Li et al., 2015
intersegmental vessel structure, abnormal Fig. S3 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal Fig. 2 with imageFig. 5 with imageFig. 6 with image from Li et al., 2015
parachordal vessel absent, abnormal Fig. S3 with image from Li et al., 2015
pericardium edematous, abnormal Fig. S3 with image from Li et al., 2015
posterior cardinal vein GFP expression decreased amount, abnormal Fig. 2 with image from Li et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal Fig. 3 with image from Li et al., 2015
subintestinal vein structure, abnormal Fig. S3 with image from Li et al., 2015
vasculature development disrupted, abnormal Fig. 2 with image from Li et al., 2015
vein flt4 expression decreased distribution, abnormal Fig. 3 with image from Li et al., 2015
vein mrc1a expression decreased distribution, abnormal Fig. 3 with image from Li et al., 2015
vein cell decreased amount, abnormal Fig. 3 with image from Li et al., 2015
whole organism flt4 expression decreased amount, abnormal Fig. 3 with image from Li et al., 2015

Phenotype of all Fish created by or utilizing MO4-nr2f1b
Phenotype Fish Conditions Figures
vein flt4 expression decreased distribution, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
pericardium edematous, abnormal TL + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
eye decreased size, abnormal TL + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
vein mrc1a expression decreased distribution, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
whole organism flt4 expression decreased amount, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
posterior cardinal vein GFP expression decreased amount, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel decreased length, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2015
angioblast cell migration decreased process quality, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
vasculature development disrupted, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel incomplete structure, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel spatial pattern, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 3 with image from Li et al., 2015
angioblast cell migration decreased process quality, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
vein cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 3 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal ci5Tg; y7Tg + MO4-nr2f1b standard conditions Fig. 2 with imageFig. 6 with image from Li et al., 2015
parachordal vessel absent, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
dorsal longitudinal anastomotic vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
subintestinal vein structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
intersegmental vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
intersegmental vessel cell amount, ameliorated ci5Tg; y7Tg + MO4-nr2f1b + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
OTHER MO4-nr2f1b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)