Morpholino

MO4-nr2f1b

ID
ZDB-MRPHLNO-160211-4
Name
MO4-nr2f1b
Previous Names
  • nr2f1b i1e2MO (1)
Target
Sequence
5' - AACCGCTATCAGAACACAGAGAGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nr2f1b
Expressed Gene Anatomy Figures
efnb2a Fig. 3 with image from Li et al., 2015
flt4 Fig. 3 with image from Li et al., 2015
mrc1a Fig. 3 with image from Li et al., 2015
notch3 Fig. 3 with image from Li et al., 2015
Phenotype
Phenotype resulting from MO4-nr2f1b
Phenotype Fish Figures
angioblast cell migration decreased process quality, abnormal y7Tg + MO4-nr2f1b Fig. 5 with image from Li et al., 2015
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
dorsal longitudinal anastomotic vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
eye decreased size, abnormal TL + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
intersegmental vessel decreased length, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image,  Fig. 5 with image from Li et al., 2015
intersegmental vessel incomplete structure, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
intersegmental vessel spatial pattern, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
intersegmental vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal y7Tg + MO4-nr2f1b Fig. 2 with image,  Fig. 5 with image,  Fig. 6 with image from Li et al., 2015
parachordal vessel absent, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
pericardium edematous, abnormal TL + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
posterior cardinal vein GFP expression decreased amount, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal y7Tg + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
subintestinal vein structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
vasculature development disrupted, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
vein flt4 expression decreased distribution, abnormal TL + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
vein mrc1a expression decreased distribution, abnormal TL + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
vein cell decreased amount, abnormal y7Tg + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
whole organism flt4 expression decreased amount, abnormal TL + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
Phenotype of all Fish created by or utilizing MO4-nr2f1b
Phenotype Fish Conditions Figures
vein flt4 expression decreased distribution, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
pericardium edematous, abnormal TL + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
eye decreased size, abnormal TL + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
vein mrc1a expression decreased distribution, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
whole organism flt4 expression decreased amount, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
posterior cardinal vein GFP expression decreased amount, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel decreased length, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image,  Fig. 5 with image from Li et al., 2015
angioblast cell migration decreased process quality, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
vasculature development disrupted, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel incomplete structure, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel spatial pattern, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 3 with image from Li et al., 2015
angioblast cell migration decreased process quality, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
vein cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 3 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal ci5Tg; y7Tg + MO4-nr2f1b standard conditions Fig. 2 with image,  Fig. 6 with image from Li et al., 2015
parachordal vessel absent, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
dorsal longitudinal anastomotic vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
subintestinal vein structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
intersegmental vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
intersegmental vessel cell amount, ameliorated ci5Tg; y7Tg + MO4-nr2f1b + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.