Morpholino

MO1-slc26a2

ID

ZDB-MRPHLNO-151215-2

Name

MO1-slc26a2

Previous Names

None

Target

slc26a2 (1)

Sequence

5' - TTGGTTGCAGGTGTTGATGGGTCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 14

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-slc26a2

No data available

Phenotype

Phenotype resulting from MO1-slc26a2

Phenotype	Fish	Figures
anterior lateral line neuromast hair cell apoptotic, abnormal	AB + MO1-slc26a2	Fig. 6 from Liu et al., 2015
auditory receptor cell stereocilium decreased amount, abnormal	AB + MO1-slc26a2	Fig. 5 from Liu et al., 2015
lateral line neuromast decreased amount, abnormal	s356tTg + MO1-slc26a2	Fig. 5 from Liu et al., 2015
lateral line neuromast hair cell decreased amount, abnormal	s356tTg + MO1-slc26a2	Fig. 5 from Liu et al., 2015
Mauthner neuron excitatory postsynaptic potential amplitude, abnormal	AB + MO1-slc26a2	Fig. 8 from Liu et al., 2015
neuromast hair cell decreased amount, abnormal	s356tTg + MO1-slc26a2	Fig. 7 from Liu et al., 2015
neuromast hair cell disorganized, abnormal	s356tTg + MO1-slc26a2	Fig. 5 from Liu et al., 2015
otolith amount, abnormal	AB + MO1-slc26a2	Fig. 3 from Liu et al., 2015
otolith decreased size, abnormal	AB + MO1-slc26a2	Fig. 3 from Liu et al., 2015
otolith fused with otolith, abnormal	AB + MO1-slc26a2	Fig. 3 from Liu et al., 2015
otolith mislocalised, abnormal	AB + MO1-slc26a2	Fig. 3 from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal	AB + MO1-slc26a2 + MO4-tp53	Fig. 6 from Liu et al., 2015
semicircular canal malformed, abnormal	AB + MO1-slc26a2	Fig. 3 , Fig. 5 from Liu et al., 2015
sensory perception of sound disrupted, abnormal	AB + MO1-slc26a2	Fig. 8 from Liu et al., 2015
startle response disrupted, abnormal	AB + MO1-slc26a2	Fig. 8 from Liu et al., 2015
swimming behavior process quality, abnormal	AB + MO1-slc26a2	Fig. 8 from Liu et al., 2015

Phenotype of all Fish created by or utilizing MO1-slc26a2

Phenotype	Fish	Conditions	Figures
Mauthner neuron excitatory postsynaptic potential amplitude, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 8 from Liu et al., 2015
auditory receptor cell stereocilium decreased amount, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 5 from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 6 from Liu et al., 2015
anterior lateral line neuromast hair cell apoptotic, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 6 from Liu et al., 2015
otolith fused with otolith, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 3 from Liu et al., 2015
otolith mislocalised, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 3 from Liu et al., 2015
startle response disrupted, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 8 from Liu et al., 2015
semicircular canal malformed, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 3 , Fig. 5 from Liu et al., 2015
otolith amount, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 3 from Liu et al., 2015
swimming behavior process quality, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 8 from Liu et al., 2015
sensory perception of sound disrupted, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 8 from Liu et al., 2015
otolith decreased size, abnormal	AB + MO1-slc26a2	standard conditions	Fig. 3 from Liu et al., 2015
anterior lateral line neuromast hair cell apoptotic, abnormal	AB + MO1-slc26a2 + MO4-tp53	standard conditions	Fig. 6 from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal	AB + MO1-slc26a2 + MO4-tp53	standard conditions	Fig. 6 from Liu et al., 2015
neuromast hair cell disorganized, abnormal	s356tTg + MO1-slc26a2	standard conditions	Fig. 5 from Liu et al., 2015
neuromast hair cell decreased amount, abnormal	s356tTg + MO1-slc26a2	standard conditions	Fig. 7 from Liu et al., 2015
lateral line neuromast decreased amount, abnormal	s356tTg + MO1-slc26a2	standard conditions	Fig. 5 from Liu et al., 2015
lateral line neuromast hair cell decreased amount, abnormal	s356tTg + MO1-slc26a2	standard conditions	Fig. 5 from Liu et al., 2015

Citations

Include unpublished citations

Liu, F., Xia, W., Hu, J., Wang, Y., Yang, F., Sun, S., Zhang, J., Jiang, N., Wang, H., Tian, W., Wang, X., Ma, D. (2015) Solute Carrier Family 26 Member a2 (slc26a2) Regulates Otic Development and Hair Cell Survival in Zebrafish. PLoS One. 10:e0136832

1 - 1 of 1

Show