ZFIN ID: ZDB-MRPHLNO-151124-1
Morpholino Name: MO4-jun
Target: jun (1)
Previous Name: c-jun_ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTCCATCTTGGTAGACATAGAAGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-jun No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-jun No data available
PHENOTYPE
Phenotype resulting from MO4-jun
No data available

Phenotype of all Fish created by or utilizing MO4-jun
Genome Resources:
CITATIONS (2)