Morpholino

MO1-zmiz2

ID
ZDB-MRPHLNO-150903-1
Name
MO1-zmiz2
Previous Names
None
Target
Sequence
5' - AGTCACTGCGGACAGAAACACACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zmiz2
No data available
Phenotype
Phenotype resulting from MO1-zmiz2
Phenotype Fish Figures
DEL cell migration decreased rate, abnormal WT + MO1-zmiz2 Fig. 6 with image from Moreno-Ayala et al., 2015
DEL cell migration process quality, abnormal WT + MO1-zmiz2 Fig. 6 with image from Moreno-Ayala et al., 2015
dorsal/ventral pattern formation process quality, abnormal WT + MO1-zmiz2 Fig. 5 with image from Moreno-Ayala et al., 2015
endodermal cell mislocalised, abnormal WT + MO1-zmiz2 Fig. 6 with image from Moreno-Ayala et al., 2015
floor plate increased width, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. 4 with image from Moreno-Ayala et al., 2015
head cell death increased occurrence, abnormal WT + MO1-zmiz2 Fig. 2 with imageFig. S1 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 Fig. 2 with imageFig. S1 with image from Moreno-Ayala et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 Fig. S1 with image from Moreno-Ayala et al., 2015
shield increased size, abnormal WT + MO1-zmiz2 Fig. 5 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. 2 with imageFig. 8 with imageFig. S6 with image from Moreno-Ayala et al., 2015
whole organism elongated, abnormal WT + MO1-zmiz2 Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. 2 with imageFig. 8 with imageFig. S6 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism ovate, abnormal WT + MO1-zmiz2 Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 Fig. S1 with image from Moreno-Ayala et al., 2015
Phenotype of all Fish created by or utilizing MO1-zmiz2
Phenotype Fish Conditions Figures
shield increased size, abnormal WT + MO1-zmiz2 standard conditions Fig. 5 with image from Moreno-Ayala et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism elongated, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
head cell death increased occurrence, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with imageFig. S1 with image from Moreno-Ayala et al., 2015
DEL cell migration decreased rate, abnormal WT + MO1-zmiz2 standard conditions Fig. 6 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism ovate, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with imageFig. S1 with image from Moreno-Ayala et al., 2015
endodermal cell mislocalised, abnormal WT + MO1-zmiz2 standard conditions Fig. 6 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
dorsal/ventral pattern formation process quality, abnormal WT + MO1-zmiz2 standard conditions Fig. 5 with image from Moreno-Ayala et al., 2015
DEL cell migration process quality, abnormal WT + MO1-zmiz2 standard conditions Fig. 6 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
floor plate increased width, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 4 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 2 with imageFig. 8 with imageFig. S6 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 2 with imageFig. 8 with imageFig. S6 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
whole organism physical object quality, abnormal WT + MO1-tdgf1 + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
Citations