Morpholino

MO2-cul4a

ID
ZDB-MRPHLNO-150402-10
Name
MO2-cul4a
Previous Names
  • cul4a-MO1 (1)
Target
Sequence
5' - CTTGGGTCTGTCTGTAACACACAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cul4a
No data available
Phenotype
Phenotype resulting from MO2-cul4a
Phenotype Fish Figures
atrium shape, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
atrium cell spatial pattern, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
blood cell decreased amount, abnormal WT + MO2-cul4a Fig. 1 with image,  Fig. 5 with image from Yang et al., 2019
cardiac ventricle shape, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
cardiac ventricle cell spatial pattern, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
caudal fin curled, abnormal TU + MO2-cul4a Fig. 2 from Zhao et al., 2015
erythroblast gata1a expression decreased distribution, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
heart morphology, abnormal zf545Tg + MO2-cul4a Fig. 5 from Zhao et al., 2015
heart shape, abnormal zf545Tg + MO2-cul4a Fig. 3,  Fig. 5 from Zhao et al., 2015
heart apoptotic process increased process quality, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
heart cell population proliferation decreased process quality, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
heart contraction rhythm quality, abnormal zf545Tg + MO2-cul4a Fig. 3 from Zhao et al., 2015
heart looping process quality, abnormal zf545Tg + MO2-cul4a Fig. 2,  Fig. 3,  Fig. 4 from Zhao et al., 2015
hematopoietic cell tal1 expression decreased amount, abnormal WT + MO2-cul4a Fig. 4 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased amount, abnormal WT + MO2-cul4a Fig. 4 with image from Yang et al., 2019
hematopoietic cell tal1 expression decreased distribution, abnormal WT + MO2-cul4a Fig. 4 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased distribution, abnormal WT + MO2-cul4a Fig. 4 with image,  Fig. 5 with image from Yang et al., 2019
hindbrain edematous, abnormal TU + MO2-cul4a Fig. 2 from Zhao et al., 2015
nucleate erythrocyte hemoglobin complex hbbe3 expression absent, abnormal WT + MO2-cul4a Fig. 1 with image from Yang et al., 2019
nucleate erythrocyte hemoglobin complex hbbe3 expression decreased distribution, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
pectoral fin absent, abnormal TU + MO2-cul4a Fig. 2,  Fig. 6 from Zhao et al., 2015
pectoral fin decreased length, abnormal TU + MO2-cul4a Fig. 6 from Zhao et al., 2015
pectoral fin truncated, abnormal TU + MO2-cul4a Fig. 2,  Fig. 6 from Zhao et al., 2015
pectoral fin cell population proliferation decreased process quality, abnormal TU + MO2-cul4a Fig. 6 from Zhao et al., 2015
pericardium edematous, abnormal TU + MO2-cul4a Fig. 2 from Zhao et al., 2015
whole organism lmo2 expression decreased amount, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
whole organism gata1a expression decreased amount, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
whole organism hbbe3 expression decreased amount, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
Phenotype of all Fish created by or utilizing MO2-cul4a
Phenotype Fish Conditions Figures
pectoral fin truncated, abnormal TU + MO2-cul4a standard conditions Fig. 2,  Fig. 6 from Zhao et al., 2015
pericardium edematous, abnormal TU + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
heart cell population proliferation decreased process quality, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
atrium cell spatial pattern, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
heart apoptotic process increased process quality, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
caudal fin curled, abnormal TU + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin decreased length, abnormal TU + MO2-cul4a standard conditions Fig. 6 from Zhao et al., 2015
heart looping process quality, abnormal TU + MO2-cul4a standard conditions Fig. 2,  Fig. 4 from Zhao et al., 2015
cardiac ventricle shape, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
hindbrain edematous, abnormal TU + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin absent, abnormal TU + MO2-cul4a standard conditions Fig. 2,  Fig. 6 from Zhao et al., 2015
atrium shape, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
pectoral fin cell population proliferation decreased process quality, abnormal TU + MO2-cul4a standard conditions Fig. 6 from Zhao et al., 2015
cardiac ventricle cell spatial pattern, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
hematopoietic cell tal1 expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image from Yang et al., 2019
nucleate erythrocyte hemoglobin complex hbbe3 expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image,  Fig. 5 with image from Yang et al., 2019
whole organism gata1a expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
nucleate erythrocyte hemoglobin complex hbbe3 expression absent, abnormal WT + MO2-cul4a standard conditions Fig. 1 with image from Yang et al., 2019
blood cell decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 1 with image,  Fig. 5 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image from Yang et al., 2019
whole organism lmo2 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
hematopoietic cell tal1 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image from Yang et al., 2019
whole organism hbbe3 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
erythroblast gata1a expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
heart contraction rhythm quality, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 3 from Zhao et al., 2015
heart morphology, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
heart looping process quality, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 3 from Zhao et al., 2015
heart cell population proliferation decreased process quality, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
heart shape, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 3,  Fig. 5 from Zhao et al., 2015
heart looping process quality, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin truncated, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pericardium edematous, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin absent, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
Citations