Morpholino

MO2-cul4a

ID
ZDB-MRPHLNO-150402-10
Name
MO2-cul4a
Previous Names
  • cul4a-MO1 (1)
Target
Sequence
5' - CTTGGGTCTGTCTGTAACACACAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cul4a
No data available
Phenotype
Phenotype resulting from MO2-cul4a
Phenotype Fish Figures
atrium shape, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
atrium cell spatial pattern, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
blood cell decreased amount, abnormal WT + MO2-cul4a Fig. 1 with image,  Fig. 5 with image from Yang et al., 2019
cardiac ventricle shape, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
cardiac ventricle cell spatial pattern, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
caudal fin curled, abnormal TU + MO2-cul4a Fig. 2 from Zhao et al., 2015
erythroblast gata1a expression decreased distribution, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
heart morphology, abnormal zf545Tg + MO2-cul4a Fig. 5 from Zhao et al., 2015
heart shape, abnormal zf545Tg + MO2-cul4a Fig. 3,  Fig. 5 from Zhao et al., 2015
heart apoptotic process increased process quality, abnormal TU + MO2-cul4a Fig. 5 from Zhao et al., 2015
heart cell population proliferation decreased process quality, abnormal zf545Tg + MO2-cul4a Fig. 5 from Zhao et al., 2015
heart contraction rhythm quality, abnormal zf545Tg + MO2-cul4a Fig. 3 from Zhao et al., 2015
heart looping process quality, abnormal zf545Tg + MO2-cul4a Fig. 2,  Fig. 3,  Fig. 4 from Zhao et al., 2015
hematopoietic cell tal1 expression decreased amount, abnormal WT + MO2-cul4a Fig. 4 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased amount, abnormal WT + MO2-cul4a Fig. 4 with image from Yang et al., 2019
hematopoietic cell tal1 expression decreased distribution, abnormal WT + MO2-cul4a Fig. 4 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased distribution, abnormal WT + MO2-cul4a Fig. 4 with image,  Fig. 5 with image from Yang et al., 2019
hindbrain edematous, abnormal TU + MO2-cul4a Fig. 2 from Zhao et al., 2015
nucleate erythrocyte hemoglobin complex hbbe3 expression absent, abnormal WT + MO2-cul4a Fig. 1 with image from Yang et al., 2019
nucleate erythrocyte hemoglobin complex hbbe3 expression decreased distribution, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
pectoral fin absent, abnormal TU + MO2-cul4a Fig. 2,  Fig. 6 from Zhao et al., 2015
pectoral fin decreased length, abnormal TU + MO2-cul4a Fig. 6 from Zhao et al., 2015
pectoral fin truncated, abnormal TU + MO2-cul4a Fig. 2,  Fig. 6 from Zhao et al., 2015
pectoral fin cell population proliferation decreased process quality, abnormal TU + MO2-cul4a Fig. 6 from Zhao et al., 2015
pericardium edematous, abnormal TU + MO2-cul4a Fig. 2 from Zhao et al., 2015
whole organism lmo2 expression decreased amount, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
whole organism gata1a expression decreased amount, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
whole organism hbbe3 expression decreased amount, abnormal WT + MO2-cul4a Fig. 5 with image from Yang et al., 2019
Phenotype of all Fish created by or utilizing MO2-cul4a
Phenotype Fish Conditions Figures
pectoral fin truncated, abnormal TU + MO2-cul4a standard conditions Fig. 2,  Fig. 6 from Zhao et al., 2015
pericardium edematous, abnormal TU + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
heart cell population proliferation decreased process quality, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
atrium cell spatial pattern, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
heart apoptotic process increased process quality, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
caudal fin curled, abnormal TU + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin decreased length, abnormal TU + MO2-cul4a standard conditions Fig. 6 from Zhao et al., 2015
heart looping process quality, abnormal TU + MO2-cul4a standard conditions Fig. 2,  Fig. 4 from Zhao et al., 2015
cardiac ventricle shape, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
hindbrain edematous, abnormal TU + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin absent, abnormal TU + MO2-cul4a standard conditions Fig. 2,  Fig. 6 from Zhao et al., 2015
atrium shape, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
pectoral fin cell population proliferation decreased process quality, abnormal TU + MO2-cul4a standard conditions Fig. 6 from Zhao et al., 2015
cardiac ventricle cell spatial pattern, abnormal TU + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
hematopoietic cell tal1 expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image from Yang et al., 2019
nucleate erythrocyte hemoglobin complex hbbe3 expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image,  Fig. 5 with image from Yang et al., 2019
whole organism gata1a expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
nucleate erythrocyte hemoglobin complex hbbe3 expression absent, abnormal WT + MO2-cul4a standard conditions Fig. 1 with image from Yang et al., 2019
blood cell decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 1 with image,  Fig. 5 with image from Yang et al., 2019
hematopoietic cell lmo2 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image from Yang et al., 2019
whole organism lmo2 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
hematopoietic cell tal1 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 4 with image from Yang et al., 2019
whole organism hbbe3 expression decreased amount, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
erythroblast gata1a expression decreased distribution, abnormal WT + MO2-cul4a standard conditions Fig. 5 with image from Yang et al., 2019
heart contraction rhythm quality, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 3 from Zhao et al., 2015
heart morphology, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
heart looping process quality, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 3 from Zhao et al., 2015
heart cell population proliferation decreased process quality, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 5 from Zhao et al., 2015
heart shape, abnormal zf545Tg + MO2-cul4a standard conditions Fig. 3,  Fig. 5 from Zhao et al., 2015
heart looping process quality, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin truncated, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pericardium edematous, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
pectoral fin absent, abnormal TU + MO1-cul4b + MO2-cul4a standard conditions Fig. 2 from Zhao et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.